Labshake search
Citations for Bio-Rad :
1 - 50 of 2497 citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% 2- mercaptoethanol (1610710, Bio-Rad, Hercules, CA) and heated at 95°C for 5 min to denature ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... Membranes were blocked for 2 hours in 5% non-fat milk (BioRad) in 1x TBS-T (10 mM tris-HCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2-5 min and scanned with GS-800 densitometer (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% (v/v) anhydrous 2-mercaptoethanol (#1610710XTU, Bio-Rad, Hercules, CA, USA). The resulting mixture was then boiled for 15 min and then 35 µl of each sample was loaded into individual wells of 10–20% ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Plant Biology 2023Quote: ... Each reaction contained 5 μL of 2 x iQ SYBR Green supermix (Bio-Rad), 2 μL of diluted cDNA (10 times dilution for shoots and roots ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then resuspended in RPMI complete media at 1×106 cells/ml and stimulated with 5 µg/ml of anti-Igκ plus anti-Igλ F(ab’)2 antibodies (BioRad, Table 2) for the indicated time at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 5% w/v of SM-2 Biobeads (BioRad, 152-8920), cleaned with 2% TX-114 for 2 h and regenerated with 30 CV of methanol ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-5 µg of target protein was resuspended in 2× Laemmli Sample Buffer (Bio-Rad) with adding 1:20 Beta-mercaptoethanol and 15 µL of the mixture was added onto Any kD™ Criterion™ TGX Stain-Free™ Protein gel (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (BioRad). Primers were designed using Benchling and purchased from Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... cells were stimulated with 5 μg/ml anti-Igκ plus anti-Igλ F(ab’)2 antibodies (BioRad). After 5 min of data acquisition ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL of Precision Plus Dual Xtra Protein Standards (2–250 kDa) were used (Bio-Rad Laboratories). Oligomerization patterns were visualized using silver staining.
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μl of the cDNA sample were supplemented with 5 μL of SsoADV Universal SYBR Green Supermix (BioRad) mix 2X ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Developmental Biology 2022Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Nuclear and cytosolic fractions of iPSCs-differentiated cells were acquired using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific #78833 ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were subsequently blocked for 2 h at room temperature with 5% non-fat milk (Bio-Rad, Hercules, CA, USA) or 5% bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Cell Biology 2023Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Protein samples were loaded on 4-15% polyacrylamide gels (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... Digested DNA was purified and 2–5 μg of DNA was run on a 1% PFGE agarose gel (Bio-Rad) in 0.5 × TBE buffer using the CHEF-DRII system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were then diluted 1:10 and 2 µL of diluted cDNA were used for RT-qPCR along with 5 µL of iTaq universal SYBR mix (Bio-Rad), 1.5 µL of primers (1.5 µM mix of forward and reverse ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were incubated with appropriate primary and secondary antibodies listed in Table 2 in 5% milk and developed using the Clarity Western enhanced chemiluminescence substrate system (1705060, Bio-Rad) in a Xograph Compact X5 processor ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified supernatant was filtered through a 0.4 μM filter to remove the insoluble fraction and supplemented with 30 mM Imidazole pH 7.0 immediately before loading at a flow rate of 2 mL/min onto a 5 mL Ni-NTA immobilized metal affinity chromatography (IMAC) column (Bio-Rad) equilibrated in Buffer A (50 mM Tris-Cl ...
-
bioRxiv - Cancer Biology 2020Quote: ... The beads were washed five times with IP lysis buffer and were boiled for 5-10 min in 2 times Laemmli sample buffer (#1610737, Bio-Rad) with 2-mercaptoethanol (#BP176-100 ...
-
bioRxiv - Immunology 2020Quote: ... in reducing or nonreducing conditions using SuperSep Ace 5%–20% gradient polyacrylamide gel (FUJIFILM Wako Pure Chemical, Osaka, Japan) and 2 × Laemmli Sample Buffer (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: Protein analysis was performed using Bioplex assays (27-Plex, CXCL-1-, CXCL-2-, CXCL-5-, CCL22-single plex) (Bio-Rad Laboratories) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was filtered through a 0.4 μM filter to remove the insoluble fraction and supplemented with 30 mM Imidazole pH 7.0 immediately before loading at a flow rate of 2 mL/min onto a 5 mL Ni-NTA immobilized metal affinity chromatography (IMAC) column (Bio-Rad) equilibrated in Buffer A (50 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by washes at room temperature (1 x 15 min, 2 x 5 min) and incubation with HRP-conjugated secondary antibodies (Bio-Rad) for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription (RT) was performed from 2 to 5 µg of RNA with iScript Adv cDNA synthesis kit (Bio-Rad #1725038). The cDNA was diluted 5 times and 1 μL of this was used for each reaction in real-time PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate; Bio-Rad Laboratories).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were resuspended in 2 ml of 10% sorbitol and 40 μl per transformation mixed with up to 5 μl of plasmids were electroporated in 2 mm cuvettes (Gene Pulser Xcell BIO-RAD). For autoactivation controls ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were transferred to a nitrocellulose membrane using the iBlot 2 device and membranes were blocked for 1 hour at RT in 5% (w/v) Blotting Grade Blocker/PBS (Biorad, #170-6404). GCase was detected using rb mAb to hGBA antibody (abcam ...
-
bioRxiv - Physiology 2022Quote: ... Primers flanking the target site were used to amplify the target region of the gene in a 10 µL polymerase chain reaction (PCR) containing: 5 µL 2 × SuperMix (Bio-Rad, Hercules, CA), 1 µL genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg in vitro transcripts were transfected into 5,000,000 cells resuspended in 400 µL cytomix containing 2 mM ATP and 5 mM glutathione using a Gene Pulser Electroporator (Bio-Rad, Munich, Germany). Cells were immediately transferred into 12 mL fresh medium and seeded in 96-well plates at density of 20,000 cells/well for replication assays and 12 mL/10cm dish for virus production.
-
bioRxiv - Molecular Biology 2023Quote: ... Ten-fold diluted cDNA samples (2 μl) were added to a mixture (10 μl total volume) containing iQ™ SYBR® Green Supermix (5 μl; Bio-Rad) and the primers of interest at a final concentration of 10 μM ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-5 µg of the non-denatured protein samples were diluted 1:1 with the native sample buffer (BIO-RAD #161-0738) and loaded into the polymerized gel ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Biochemistry 2020Quote: ... were incubated together at RT for 5 min in the presence and absence of 5 mM 2-OG prior to loading on the analytical ENrich 650 column (BioRad Laboratories, Inc., Hecules, USA). The column was equilibrated with 50 mM Tris/HCl and 150 mM NaCl and supplemented with 5 mM 2-oxoglutarate when the complexes were preincubated in the presence of 5 mM 2-oxoglutarate and the applied proteins isocratic eluted with the respective buffer with a flow rate of 1 ml min-1 ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...