Labshake search
Citations for Bio-Rad :
1 - 50 of 6373 citations for 4 Methoxy 2 3 3 4 5 Pentacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 30-50 ug of protein was loaded onto a 4-15% gel (Bio-Rad), run in Tris-Glycine buffer at 100V for 2 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... were heated at 99 °C for 3 minutes and subjected to 4-20% gradient SDS-PAGE prior to transfer to nitrocellulose membranes (Bio-Rad Laboratories, Inc.). Membranes were then blocked for 1 hour with 5% (w/v ...
-
bioRxiv - Systems Biology 2020Quote: ... 50 mM DTT) and 3 mL oil (Biorad #1864006). After encapsulation ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Cancer Biology 2020Quote: ... Equal masses of protein (5 ug – 40 ug) were separated by 4—15% of SDS/ PAGE and were transferred onto nitrocellulose membranes (Bio-Rad) for protein blot analysis ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 50 ug of protein was loaded onto 4-15% Mini-Protean TGX (4561084, Bio-Rad, Hercules, CA) gels ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 50 to 100 ug protein was loaded in each lane and separated on 4–20% precast polyacrylamide gel (17000436, Biorad) and transferred on PVDF membrane (1704156 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Western blots were loaded at 2.5 to 50 ug total protein per lane in 4-20% gradient pre-cast polyacrylamide gels (#3450033, Bio-Rad). Gels were also loaded with the Dual pre-stained protein standards (#1610374 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 ml bed volume (0.8 × 4 cm) empty polypropylene column (BioRad) fitted with a two-way stopcock up to the fill line ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... after 3-4 hrs the beads were passed through Econo-Pac chromatography columns (Bio-Rad) and washed with 20x bead volume of wash buffer in the following order ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were boiled for 3 minutes and separated on a 4-20% precast polyacrylamide gel (Biorad).
-
bioRxiv - Immunology 2023Quote: Fab (3 μg/lane) was loaded on a 4%-12% Bis-Tris precast gel (Bio-rad) in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Molecular Biology 2022Quote: ... lysates from 3×106 cells were separated on 4-20 % gradient Tris-glycine polyacrylamide gels (BioRad 4568094), electroblotted onto a PVDF membrane (Pierce 88518) ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 20-40 ug was loaded onto 4-15% pre-cast gels (Bio-Rad 17000546) and run using the Bio-Rad Mini-PROTEAN Tetra Cell system ...
-
bioRxiv - Biochemistry 2019Quote: ... with or without CLEC-2 antibody (3 μg/ml final concentration; Bio-Rad, Oxford, UK). The plate was incubated in the dark for the indicated time and the reaction was stopped by addition of 200 μl 1% ice-cold formalin ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg of protein was separated on 4% to 20% precast polyacrylamide gels (Bio-Rad, cat # 4561095) for detection of histone H3 andH3K27me3 ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were blocked overnight at 4°C in PBS with 3% BSA and 10% donkey serum (Bio-Rad), stained with DAPI (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Approximately 20 ug protein was analyzed by 4%–15% gradient TGX Precast polyacrylamide gel (Bio-Rad), transferred onto a PVDF membrane (Biorad Transblot Turbo system ...
-
bioRxiv - Microbiology 2019Quote: ... and 3 mg Bromophenol Blue) were separated by SDS-PAGE using 4-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...