Labshake search
Citations for Bio-Rad :
501 - 550 of 6373 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-IBA-1 antibody (0.4 μg/mL, FUJIFILM Wako) and rat anti-CD68 antibody (5 μg/mL, clone FA-11, Bio-Rad) was used ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.5 and loaded onto a 2 ml CHT2-I hydroxyapatite column (Bio-Rad) equilibrated in 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-15% Mini Protean gels (BioRad). Proteins were transferred to nitrocellulose membrane using Turbo-blotter (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 4% goat (Bio-Rad Laboratories, #C07SA) or donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2020Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (DY485 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4-15% (BIO-RAD #456-1083) Mini PROTEAN® gel in Tris/Glycine/SDS (BIO-RAD #1610772) ...
-
bioRxiv - Neuroscience 2022Quote: Criterion TGX 4-15% (Bio-Rad 5671084) and Mini-Protean TGX precast gels (Bio-Rad 4561083 ...
-
bioRxiv - Molecular Biology 2021Quote: 4-20% precast SDS PAGE gels (BioRad) were used for electrophoretic separation of immuno purified samples ...
-
bioRxiv - Immunology 2021Quote: ... 4-15% gradient gels (Bio-Rad 4561086) and transferred to PVDF membranes (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... run on 4-20 % polyacrylamide gels (BioRad) according to manufacturer’s instructions and analyzed by adding InstantBlue (Expedeon).
-
bioRxiv - Microbiology 2019Quote: ... loaded on 4-20% polyacrylamide gels (BioRad), and transferred to Immobilon-P Transfer Membranes (Millipore Corp) ...
-
bioRxiv - Genetics 2021Quote: ... 4% (wt/vol) acrylamide (Bio-Rad, USA), 0.05% (wt/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... 4% w/v acrylamide (Bio-Rad 1610140), 0.05% w/v bis-acrylamide (Bio-Rad 1610142) ...
-
bioRxiv - Plant Biology 2020Quote: ... in 4-mm electroporation cuvettes (Bio-Rad) with the following setting ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad, Hercules, California), and in the case of immunoblot analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... separated in 4-20% SDS–PAGE (BioRad) and electroblotted to nitrocellulose membrane ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 4-20% TGX (Bio-Rad, 4561096) for visualization of auto- ubiquitylation or substrate ubiquitylation ...
-
bioRxiv - Bioengineering 2022Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (430104 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 mm gap (Bio-Rad, Hercules, CA) containing 20 µg pCas-Ov-grn-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... separated by 4-15% SDS-PAGE (BioRad), transferred and treated with a polyclonal rabbit anti-TDP-43 antibody (ProteinTech ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4-20% Tris-glycine gel (BioRad) and blotted on a PVDF membrane (BioRad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by 15 minutes at 50°C and 5 minutes at 85°C in T100 Thermal Cycler (1861096, Bio-Rad). Real-time qPCR reactions were performed using SsoAdvanced Universal SYBR® Green Supermix (1725274 ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... and proliferating cells stimulated for 5 days with α-CD3 (1µg/mL; clone UCHT1; Bio-Rad) and α-CD28/CD49d (each at 1 µg/mL ...
-
bioRxiv - Immunology 2021Quote: ... at 5 μg/mL were incubated and coupled with Affi-gel Hz Hydrazide (Biorad #156-0016). Plasma 1:100 diluted from a patient with critical COVID-19 (Val 51 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Clarified lysate was bound to a 5 ml Mini Nuvia IMAC Ni-Charged column (Bio-Rad). The resin was washed extensively with a solution of 40 mM Tris pH 8.0 ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 µg of protein was separated by SDS-PAGE using pre-cast TGX 4-15% gradient gels (BioRad). Protein was transferred to a 0.45 µm nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein samples were run on 4-20% precast polyacrylamide gel (4-20% Mini-PROTEAN TGX Precast Protein Gels, BioRad) to separate them and transferred onto PVDF membranes using semi-dry transfer ...
-
bioRxiv - Cell Biology 2023Quote: ... SDS–PAGE was carried out using 4-15% or 4-20% precast polyacrylamide gels (Bio-Rad, 4561086 or 4561093) and run at a constant voltage of 80 V for 5 min followed by 120 V for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... The eluent was isolated by centrifugation at 100 g for 4 min at 4°C (Bio-Rad 732-6204), buffer exchanged (Amicon Ultra 10 kDa MWCO UFC501024 ...
-
bioRxiv - Genomics 2024Quote: ... samples were embedded in a thin polyacrylamide film by inverting them onto a GelSlick-coated microscope slide with a droplet of 4% acrylamide solution (4% v/v 20:1 acrylamide:bis-acrylamide [BioRad, 1610144] with 0.15% v/v TEMED [Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... with DTT and resolved on 4-15% 4-20% or 12% Mini-PROTEAN® TGX™ Precast Gels (Biorad) run in Tris/Glycine/SDS running buffer (Biorad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the samples were separated on 4-20% or 4-15% Mini-PROTEAN TGX Precast Protein Gels (BioRad Laboratories). The gel was transferred to a PVDF membrane using the iBlot transfer system (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated in 2-mm cuvettes (600 V, 50 μF, 200 Ω) by using Gene Pulser Xcell (Biorad). Immediately after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...