Labshake search
Citations for Bio-Rad :
1 - 50 of 6373 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Equal masses of protein (5 ug – 40 ug) were separated by 4—15% of SDS/ PAGE and were transferred onto nitrocellulose membranes (Bio-Rad) for protein blot analysis ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 ml bed volume (0.8 × 4 cm) empty polypropylene column (BioRad) fitted with a two-way stopcock up to the fill line ...
-
bioRxiv - Cancer Biology 2020Quote: ... 30-50 ug of protein was loaded onto a 4-15% gel (Bio-Rad), run in Tris-Glycine buffer at 100V for 2 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by 4 incubations with BioBeads SM-2 (BioRad) to remove the detergent ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 50 ug of protein was loaded onto 4-15% Mini-Protean TGX (4561084, Bio-Rad, Hercules, CA) gels ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Genetics 2024Quote: ... 4 mg/ml lyticase) and blended with 300 μl of 2% low-melt agarose (Bio-Rad). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Neuroscience 2023Quote: ... 50 to 100 ug protein was loaded in each lane and separated on 4–20% precast polyacrylamide gel (17000436, Biorad) and transferred on PVDF membrane (1704156 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Western blots were loaded at 2.5 to 50 ug total protein per lane in 4-20% gradient pre-cast polyacrylamide gels (#3450033, Bio-Rad). Gels were also loaded with the Dual pre-stained protein standards (#1610374 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were then incubated (4°C, overnight) with 5 % milk powder (BioRad) in TBST ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-20μg protein were loaded onto 4-20% SDS-PAGE gels (Biorad) and run at 100V ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were clarified by a brief centrifugation (10,000 g for 5 min at 4°C) and the supernatants were collected and diluted with 2× reducing Laemmeli buffer (Bio-Rad, Hercules, CA, USA, cat. #1610737). For preparation of cell culture lysates ...
-
bioRxiv - Cell Biology 2021Quote: ... against the OAD buffer for 6h at 4 °C to remove the sucrose and then loaded on an EnrichQ 5/50 column (Bio-Rad) equilibrated with the ion-exchange buffer A (50 mM HEPES pH 7.4 ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: Cells lysates were separated on 4-2% gradient SDS-polyacrylamide gels (Biorad), transferred to polyvinylidene fluoride (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... 5%β-mercaptoethanol) and migrated on 4-15% Tris-glycine gradient gels (BioRad).
-
bioRxiv - Neuroscience 2021Quote: ... 5-10µg protein were loaded on SDS-PAGE gels (4-15% acrylamide, Biorad). After 1h of electrophoresis at 150V ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2019Quote: ... were heated at 99 °C for 3 minutes and subjected to 4-20% gradient SDS-PAGE prior to transfer to nitrocellulose membranes (Bio-Rad Laboratories, Inc.). Membranes were then blocked for 1 hour with 5% (w/v ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified supernatant was filtered through a 0.4 μM filter to remove the insoluble fraction and supplemented with 30 mM Imidazole pH 7.0 immediately before loading at a flow rate of 2 mL/min onto a 5 mL Ni-NTA immobilized metal affinity chromatography (IMAC) column (Bio-Rad) equilibrated in Buffer A (50 mM Tris-Cl ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was filtered through a 0.4 μM filter to remove the insoluble fraction and supplemented with 30 mM Imidazole pH 7.0 immediately before loading at a flow rate of 2 mL/min onto a 5 mL Ni-NTA immobilized metal affinity chromatography (IMAC) column (Bio-Rad) equilibrated in Buffer A (50 mM Tris-Cl ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2-5 min and scanned with GS-800 densitometer (Bio-Rad).
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... Membranes were blocked for 2 hours in 5% non-fat milk (BioRad) in 1x TBS-T (10 mM tris-HCl ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were sonicated and heated at 95°C for 5 minutes before their separation on a 4-15% gradient SDS PAGE gel (Biorad, 4-15%). Proteins were transferred from gel to nitrocellulose membrane using semi-dry method ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins (5 μg) were separated on a 4–15 % polyacrylamide gradient gel (Bio-Rad) and then transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Physiology 2019Quote: ... and blocked for 24 hours at 4°C in 5% blotting-grade blocker (BioRad). Blots were incubated in primary OXPHOS antibody (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Biophysics 2021Quote: ... The mixture was diluted to ~30 mL with sample buffer and stirred at 4°C for 30 min prior removal of C12E8 by adding 4 g of Bio-Beads SM-2 (Bio-Rad) in stages of 0.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...