Labshake search
Citations for Bio-Rad :
1 - 50 of 7732 citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Physiology 2024Quote: Native-PAGE gels (3% acrylamide:bis-solution 19:1 (BioRad, 1610144)/0.08% ammonium persulfate/0.006% tetramethylethylenediamine (TEMED)/1X TBE ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... mixed 3:1 with 4x Laemmli buffer (Biorad, cat. no. 1610747) containing β-mercaptoethanol and heated at 95°C for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on the 4-20% Criterion TGX Stain-Free Precast gels (BioRad) in Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified MCU-EMRE subcomplex in DDM was then reconstituted into nanodisc by incubating with Msp1 protein, lipids (POPC:POPE:POPG, 3:1:1 molar ratio) and BioBeads (BioRad) at 4°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We used 1 μL diluted cDNA (1:3 in ddH2O) and iTaq Universal SYBR Green Supermix (Bio-rad) in the Bio-rad CFX96 real-time PCR detection system for qPCR experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were collected and mixed 3:1 with 4x Laemmli sample buffer (Bio-Rad 1610747). Samples were heated at 95°C for 10 min and then separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... the DDM was removed by 3 additions of SM-2 bio-beads (Bio-Rad), incubated for 2h/2h/overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; 170-6516, Bio-Rad) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Neuroscience 2024Quote: ... solubilisates were incubated for 2 hours with 3 µg of coupled ABs (V5, BioRad, #MCA1360) or 40 µl anti-FLAG affinity resin (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were boiled for 3 minutes and separated on a 4-20% precast polyacrylamide gel (Biorad).
-
bioRxiv - Immunology 2023Quote: Fab (3 μg/lane) was loaded on a 4%-12% Bis-Tris precast gel (Bio-rad) in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS ...