Labshake search
Citations for Bio-Rad :
1 - 50 of 8069 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Immunology 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-Rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Biochemistry 2024Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on the 4-20% Criterion TGX Stain-Free Precast gels (BioRad) in Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated shaking for 1 hour at RT with 4% blocking solution (5% milk powder (BioRad) in TBS-T) ...
-
bioRxiv - Cell Biology 2024Quote: ... SARS-CoV2-PP were prepared by labelling with 0.4µM DiIC18(5) solid (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, or DID) (Thermo) with Biospin6 (Biorad) to remove residual dyes ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... After gel polymerization was performed pre-electrophoresis of empty gel in 5% acetic acid (running buffer) for 1-1.5h/150 V in reverse polarity of electrophoretic BioRad system (Bio-rad, USA). The running buffer was discarded ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... Membranes were washed with TBS-T (3 x 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed with TBST 3 times for 5 minutes each before applying secondary fluorescent antibody (1:2,500, StarBright Blue 520 Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... and blocked in Odyssey PBS blocking buffer 1:3 in 1x PBS (Li-Cor, 927-40000) or EveryBlot blocking buffer 1:3 in 1x PBS (Biorad, 12010020) for 30 min (Odyssey ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... A 1:5 dilution from serum samples was combined with 4 °C Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA) and heated at 100 °C for 10 min before loading into 12% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 1:4 and 4.3 µL of cDNA was mixed with 5 µL iTaq Universal SYBR Green Supermix (BioRad 1725124) and 0.7 µL of 5 µM forward and reverse qPCR primers targeting the gene of interest (333 nM final primer concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The blots were washed again after secondary antibody incubation and developed using either nitroblue tetrazolium (NBT)–5-bromo-4-chloro-3-indolylphosphate (BCIP) for AP-conjugated secondary antibodies or the ECL substrate (BioRad) for the HRP labelled secondary antibody after incubating for about 10 to 15 mins at room temperature with gentle shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... in 1% (v/v) acetic acid] for 1 min and photographed using Gel Doc XR system (Bio-Rad).
-
bioRxiv - Plant Biology 2024Quote: ... The membranes were stained with a 1:1 mix of glacial acetic acid and Ponceau Red (Bio-Rad) for protein visualisation ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were incubated with primary and HRP-secondary antibodies in TBST buffer with 5% milk (RT for 1 hour or overnight at 4 °C) and revealed with an ECL solution (BIO-Rad) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... and probed overnight at 4°C with IRDye 680 Streptavidin (LICOR) diluted 1:3000 in 1:1 TBST:Blocking Buffer (BioRad). Membranes were imaged using an Azure Biosystems c600 ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was diluted 1:5 (for caecum 1:1 or 1:10) and qPCR was performed on a CFX384 Touch™ (Bio-Rad) with iTaq Universal SYBR (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... mixed with Rotiload (1:4, BIO-RAD, Feldkirchen, Germany) and boiled for 5 min ...
-
bioRxiv - Microbiology 2024Quote: ... diluted 1:4 in Laemmli sample buffer (Bio-Rad) and heated for 10 minutes at 98°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Physiology 2024Quote: Native-PAGE gels (3% acrylamide:bis-solution 19:1 (BioRad, 1610144)/0.08% ammonium persulfate/0.006% tetramethylethylenediamine (TEMED)/1X TBE ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Biochemistry 2024Quote: ... Each sample was then boiled for 3-5 min at 95 ºC and resolved on a 4-20 % gradient SDS-PAGE gel (TGXTM, Bio-Rad, 4561096) at 180 Volts for ∼30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...