Labshake search
Citations for Bio-Rad :
1 - 50 of 5141 citations for 3 Phenyl 2 thioxo 2 3 dihydro 1H imidazole 4 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... the DDM was removed by 3 additions of SM-2 bio-beads (Bio-Rad), incubated for 2h/2h/overnight ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Neuroscience 2024Quote: ... solubilisates were incubated for 2 hours with 3 µg of coupled ABs (V5, BioRad, #MCA1360) or 40 µl anti-FLAG affinity resin (Millipore ...
-
bioRxiv - Plant Biology 2022Quote: ... 12.5 mM imidazole) for 3 times and boiled at 95°C with 30 μl SDS loading dye (BioRad). After removing the beads ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was then eluted in 3 mL buffer A containing 300 mM imidazole before applying the eluate onto Econo-Pac 10DG column (Bio-Rad) equilibrated with HBS to remove imidazole ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was washed 3 times with PBS-T and developed with ECL (Biorad170-5060) for 2 min and imaged on ChemiDocTMMP (Biorad).
-
bioRxiv - Biochemistry 2020Quote: ... followed by 4 incubations with BioBeads SM-2 (BioRad) to remove the detergent ...
-
bioRxiv - Physiology 2023Quote: ... and transferred (100V, 1h, 4°C) onto PVDF membranes (Bio-Rad). Blots were blocked in buffer containing 5% BSA (Cat#A9418 ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μL cDNA template and 4 μL iQ SYBR green supermix (Bio-Rad) in a total reaction volume of 12 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... The embryos were mounted on a 2 % agarose pad and heat-shocked at 30°C for 1h (Thermocycler Bio-Rad). After 2h recovery at 20°C ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 ml bed volume (0.8 × 4 cm) empty polypropylene column (BioRad) fitted with a two-way stopcock up to the fill line ...
-
bioRxiv - Synthetic Biology 2021Quote: Supernatant or periplasmic fractions were diluted 3:1 in 4× Laemmli sample buffer (Bio-Rad) and were boiled at 100 °C for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mg of post-thrombin digested claudin-4 in DDM was treated with 4 mg of amphipol (1:4 w/w) for 2 hours before removing detergent via addition of 400 mg SM-2 biobeads (Bio-Rad). Excess cCpE was added to each claudin-4 sample at a molar ratio of 1:1.5 ...