Labshake search
Citations for Bio-Rad :
101 - 150 of 1702 citations for 3 Phenoxybenzoic Acid Unlabeled 100 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 20-40 ug of protein was loaded per lane in a pre-cast gel for SDS-PAGE (Bio-Rad). Gel was then transferred using the TurboBlot Transfer (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... containing 2 ml of anion exchange resin AGMP-1M (100-200 mesh, chloride form) (BIO-RAD, 1411841). The resin was first cleansed three times with 10 ml 18.2Ω water followed by 7 ml 0.5N HNO3 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... genomic DNA was extracted using 250 mL of 5% Chelex 100 resin (Bio-Rad Laboratories, Hercules, CA) and 3 mL of proteinase K (20 mg/mL ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Plant Biology 2022Quote: ... A total of 3 ml of Ni2+- loaded resin was packed into Econo-Pac columns (cat. Number 7321010 – Bio-Rad) and equilibrated with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant from the cell lysate was collected by centrifuging the cell lysate at 10,000 g for 10 min at 4°C and further diluted in lysis buffer to 8.0 ug/ul using a modified Bradford protein quantification assay (Bio-Rad), flash-frozen in liquid N2 ...
-
bioRxiv - Physiology 2020Quote: ... equal amounts of protein (20 ug) were loaded in 4-12% - Criterion XT Bis-Tris protein gels (Bio-Rad, CA) and transferred to nitrocellulose membranes ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were boiled with SDS-PAGE sample loading buffer (6X SDS) and 30 ug of protein was loaded to each well of a 10% Tris-glycine SDS-PAGE gel (BioRad). Proteins were transferred to a PVDF membrane (Millipore) ...
-
bioRxiv - Physiology 2023Quote: ... and left ventricle of wild-type C57 Bl6 mice was incubated with PC2 antibody (10 ug, Alomone laboratories) overnight complexed to magnetic protein G beads (Biorad). Following 3 rounds of washing ...
-
bioRxiv - Cancer Biology 2023Quote: ... Western blots were loaded at 2.5 to 50 ug total protein per lane in 4-20% gradient pre-cast polyacrylamide gels (#3450033, Bio-Rad). Gels were also loaded with the Dual pre-stained protein standards (#1610374 ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 ml of supernatant was diluted with 3 ml of distilled H2O and applied to freshly prepared Dowex columns (AG1-X8; Bio-Rad). Columns were washed twice with distilled H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... LAMP reaction products were analysed on 2% agarose gels (65V for 3 hr) stained with ethidium bromide (10 mg/mL) and viewed on Gel Doc XR Imaging System (BioRad, USA).
-
bioRxiv - Systems Biology 2020Quote: ... and used 500 ng - 1 ug RNA to make cDNA using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). 0.1 of cDNA (i.e ...
-
bioRxiv - Plant Biology 2021Quote: ... ∼1 ug of RNA from resulting extraction was used as template in standard cDNA synthesis reaction (BioRad iScript cDNA Synthesis Kit). 200 ng of resulting cDNA was used in qRT-PCR reactions to quantify POL expression levels (PowerUp SYBR Green 5x Master Mix-Thermo) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The quality and concentration of the RNA was assessed and first strand cDNA synthesised from 1 ug using the iScript Select cDNA Synthesis Kit (Bio-Rad) and a 1:1 mixture of Oligo (dT ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10-15 ug of protein lysates were run on 4– 20% Criterion™ TGX™ Precast Midi Protein Gel (Bio-Rad) and then transferred to polyvinylidene difluoride membranes ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein (10 ug) from each sample was treated with ß-mercaptoethanol and subsequently electrophoresed on precast 4%–10% gradient gels (Biorad), as previously described (Alcantara et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 ug of protein from cortical samples and 45ug of muscle samples were diluted in 4x Laemmli sample buffer (Bio-Rad). P3 brain samples were already directly resuspended in 4x Laemmli sample buffer ...
-
bioRxiv - Microbiology 2022Quote: ... reagent in 0.2 mL PCR 8-well strips and heated to 100 °C for 10 min (T100; BioRad, Australia) and used immediately ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were blocked for 1hr in PBS with 1mg/ml and 0.1% triton and then stained overnight with anti-alpha Tubulin antibody (1:100, MCA78G, BioRad). Cells were then washed ...
-
bioRxiv - Molecular Biology 2024Quote: 0.2 – 1 mL (sufficient to cover the sample) of 5% Chelex 100 Resin (Bio-Rad Laboratories, Hercules, CA, USA) with 0.2% Tween20 and 0.1 mg/mL proteinase K (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... The membranes were washed three times for 5 min each with TBST and incubated with 1 mL of chemiluminescent detection reagent (Cytiva, RPN2232) for 3 min before image acquisition using a ChemiDoc MP Imaging System (Bio-Rad Laboratories). Horseradish peroxidase (HRP)-conjugated antibodies against β-actin (Cell Signaling ...
-
bioRxiv - Biochemistry 2023Quote: ... The membranes were washed three times for 5 min each with TBST and incubated with 1 mL of chemiluminescent detection reagent (Cytiva, RPN2232) for 3 min before image acquisition using a ChemiDoc MP Imaging System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2019Quote: ... and cDNA was reverse transcribed from 1 ug of the resultant RNA with the Bio-Rad iScript kit (Bio-Rad 170-8891) in a reaction volume of 20 µl ...
-
bioRxiv - Bioengineering 2023Quote: ... 15 ug protein were loaded and separated using 4–15% Mini-PROTEAN® TGX™ Precast SDS-PAGE Gels (Bio-rad, #4561086). Samples were then transferred to nitrocellulose membranes for immunoblotting ...
-
bioRxiv - Developmental Biology 2022Quote: ... the gel was incubated in 1x TBE for 10 min and after was stained with Green Safe reagent dye (5 µL /100 mL of TBE 1x) for 30 min and visualized on ChemiDoc XRS+ system (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... 10μg/μl of protein was loaded into each lane of 4–15% (mg/100 mL) Tris·HCl polyacryamide gels (Bio-Rad). Protein was transferred to Immobilon-P PVDF membranes (Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Physiology 2022Quote: ... and protein content assessed by BCA assay (Pierce) before 15 ug protein lysates were separated on a TGX Stain-Free™ criterion gel (Bio-Rad, Sweden). Following which ...
-
bioRxiv - Immunology 2021Quote: ... Basically 300 ug of IVIG protein were subjected to isoelectric focusing (IPG) across pH gradients of 4-7 (Biorad, LifeSciences, Hercules, Ca, USA) or pH 6-11 (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ug of protein was loaded onto precast gel (4561095, 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels, Bio-Rad, USA) and resolved at 200 volts for 30-35 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.5 to a salt concentration of 100 mM NaCl and loaded onto a 5 mL Bio-Scale TM Mini CHT Type II column (Bio-Rad) equilibrated with CHT column buffer (5% glycerol (w/v) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a 1:5 w/w ratio for 2 hours before addition of 100 mg mL-1 Bio-Beads SM-2 resin (Bio-Rad) and then incubated overnight at 4 °C with gentle agitation to remove detergent ...
-
bioRxiv - Molecular Biology 2023Quote: ... gels were stained with ethidium bromide (5 µL of 10 mg/mL ethidium bromide (EtBr) solution in 100 mL TAE) and imaged in a Gel Doc XR + System using the Image Lab software (Bio-Rad). Each experiment was carried out in triplicate.
-
bioRxiv - Plant Biology 2024Quote: ... and 3 filter papers (BioRad, 1620161) were immersed in 1x PBS and placed in a slot blot apparatus (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Microbiology 2020Quote: ... Colonization of SEΔΔΔ was quantified by dilution plating and counting colony forming units (CFU) on SASelect plates supplemented with 100 μg/mL D-alanine (BioRad, Hercules, CA). All experiments were done in triplicate.
-
bioRxiv - Cell Biology 2021Quote: Chelex-100 Resin (Biorad) was resuspended at 0.1 g/ml in Hyclone water (Hypure Molecular Biology Grade Water ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2020Quote: ... plates were coated with 100 μl of either 1 μg/ml of rh-TfR1-ECD (purified in-house) or liver purified ferritin (Bio-Rad, 4420-4804) overnight at 4°C ...