Labshake search
Citations for Bio-Rad :
1 - 50 of 1961 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... the membranes were washed 3 times for 10 min each with TBST buffer at 24 °C and visualized using enhanced chemiluminescence reagents (Bio-Rad Laboratories, CA, USA). The images were captured using Image Quant LAS 4000 (GE Healthcare Life Sciences ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized 1 min in a TeSeE PRECESS 24 (Bio-Rad) using 0.5 mm glass beads (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Immunology 2023Quote: ... bovis BCG-mCherry) respectively at an interval of 24 hours daily for 5 days using a fluorescence multimode plate reader (Biorad). An MOI of 1 ...
-
bioRxiv - Bioengineering 2021Quote: ... mCherry (SONY: 600/60 emission; BioRad: 561 excitation, 615/24 emission). For first experiments with a given laser configuration ...
-
bioRxiv - Bioengineering 2021Quote: ... EGFP (SONY: 525/50 emission; BioRad: 488 excitation, 509/24 emission), mCherry (SONY ...
-
bioRxiv - Molecular Biology 2023Quote: ... embryos surviving for 24 h post- injection were incubated in 100 µl of 5 % Chelex® 100 Molecular Biology Grade Resin (BioRad) and 50 µl of Proteinase K Solution (20 mg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with siRNA 24 hrs later using SilentFect (Bio-Rad): 37.5 µL OptiMEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: Cells grown at 24-well plate were lysed with Laemmli sample buffer (BioRad) and subjected to SDS-PAGE using 4-15% TGX Stain-Free polyacrylamide gels (BioRad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes washed 3 × 5 minutes in TBST then incubated in ECL reagent (BioRad, 170-5061) and imaged using a Chemidoc MP (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... probe 5’-TGCAGTCCTCGCTCACTGGGCACG-3’ using the following conditions on a CFX96 Real Time PCR (Biorad): 50°C for 5 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies (Table 3) were diluted in 5% non-fat blocking milk (BioRad, Cressier, Switzerland) in TBST and incubated over night at 4°C with mild agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1, BioRad), and traces of phenol were removed by triple extraction with equal volumes of chloroform:isoamyl alcohol (24:1) ...
-
bioRxiv - Biochemistry 2021Quote: ... 10X TBS was made by dissolving 24 g Tris Base (BIO-RAD #161-0719) and 88 g NaCl (CAS 7647-14-5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol) 3 times and moved into a 25 mL Econo-Column Chromatography Column (Bio-Rad), where they were further washed with a minimum of 200 mL of wash buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Cell Biology 2023Quote: Cell culture images were taken every 24 h on Zoe Fluorescent cell imager (Bio-Rad). Three individual images were taken per condition and timepoint ...
-
bioRxiv - Cell Biology 2024Quote: ... SARS-CoV2-PP were prepared by labelling with 0.4µM DiIC18(5) solid (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate Salt, or DID) (Thermo) with Biospin6 (Biorad) to remove residual dyes ...
-
bioRxiv - Microbiology 2020Quote: ... Single cells were sorted into 16 × 24 matrices onto URISelect™ 4 agar plates (Bio-Rad) prepared in Nunc™ OmniTray™ Single-Well Plates (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... This was all done in under 24 hr using a standard C1000 Touch Thermal Cycler (BioRad). The sequences for all linear and minimal genetic templates used are in the accompanying supplementary information.
-
bioRxiv - Biochemistry 2024Quote: ... 2) Arm B was purified on an ENrich™ SEC 650 24 mL column (Bio-Rad), and 3 ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2023Quote: ... The concentrated samples were loaded onto a gel filtration column (Enrich SEC70, 24 ml, Bio-Rad) for purification ...
-
bioRxiv - Biochemistry 2024Quote: ... A total of 24 samples were run on the same Criterion 4–20% gel (Bio-Rad), then transferred to a PVDF membrane.
-
bioRxiv - Cell Biology 2021Quote: ... Plates were incubated at 30°C for 3-5 days and photographs were taken by Chemi Doc (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Biochemistry 2021Quote: ... 24 µg of proteins were separated on SDS-PAGE gels (BioRad 4-15% TGX pre-cast gels), followed by transfer onto Protran 0.45 µm nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... For analysis the Bio-Flex Pro™ Rat Cytokines Assay (Bio-Rad, 24-plex panel #171-K1001M) was used on a Bio-Plex® MAGPRIX™ multiplex reader and analysed with Bio-Plex Analysis software (Bio-Rad).