Labshake search
Citations for Bio-Rad :
1 - 50 of 4358 citations for 3 Hydroxy 20 oxo 5 pregnen 17alpha yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 3-8% Criterion XT tris- acetate gel (#3450130, Biorad) or 4-15% Criterion TGX gel (#5671083 ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were loaded on a 3-8% tris-acetate gel (Biorad 3450131) in Tricine running buffer (Biorad 1610790 ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated on Criterion™ XT Tris-Acetate 3–8% Protein Gels (BioRad, #3450131) in Tris/Tricine/SDS Running Buffer (BioRad ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30–100 μg protein/lane was separated on 3%–8% Tris-Acetate gels (BioRad, 3450130) and transferred to nitrocellulose membranes (GE Healthcare Life Sciences ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... The eluate was analysed by SDS-PAGE using 3-8% Criterion XT Tris-Acetate gels (Bio-Rad) and XT Tricine running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant from two reactions were collected and separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Biochemistry 2024Quote: ... Each sample was then boiled for 3-5 min at 95 ºC and resolved on a 4-20 % gradient SDS-PAGE gel (TGXTM, Bio-Rad, 4561096) at 180 Volts for ∼30 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were subjected to SDS-PAGE by resolving on a 3-8% CriterionTM XT Tris-Acetate gel (Bio-Rad) for immunoblotting.
-
bioRxiv - Biochemistry 2022Quote: Proteins for native mass spectrometry were held on ice and buffer exchanged into 75 µl of 50 mM ammonium acetate pH 7.5 by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Immunology 2021Quote: ... 0.1 % Tween 20) with 5 % nonfat dry milk (BioRad) for one hour at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Developmental Biology 2020Quote: ... Western blots were performed either with Criterion ™ XT Tris-Acetate Precast Gels 3–8 % (3450130, Bio-Rad, Hercules, CA), XT Tricine running buffer (161–0790 ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Neuroscience 2020Quote: ... containing the crude synaptosomes was resuspended and processed for western blotting in NP-40 lysis buffer as above with the following modifications: equal amounts of protein per sample (unboiled) were separated on 3-8% Tris-Acetate XT gel (Bio-Rad) in XT Tricine running buffer (Bio-Rad ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Biophysics 2020Quote: ... 0.05% Tween-20) containing 5% non-fat milk powder (Bio-Rad). Membranes were then probed with antibody in TBST containing 5% milk powder ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.05% Tween-20) containing 5% non-fat milk powder (Bio-Rad). Membranes were then probed with antibody in TBST containing 5% milk powder.
-
bioRxiv - Cell Biology 2023Quote: ... 20 μg of protein extracts were loaded and run on 5-20% gradient pre-cast gels (Bio-Rad) before being transferred onto a 0.45 μM nitrocellulose membrane (Amersham ...
-
bioRxiv - Immunology 2020Quote: ... diluted in 10 mM sodium acetate (BioRad), pH 5.0 ...
-
An anti-amyloidogenic treatment to specifically block the consolidation of traumatic events in mousebioRxiv - Animal Behavior and Cognition 2020Quote: ... PBS 0.1% Tween-20 (PBS-T) with 5% non-fat-milk (Biorad) was used to block the membrane which was later incubated with the primary antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.1% Tween-20) supplemented with 5% blotting-grade blocker (Bio-Rad #1706404) at room temperature for 2–3 h ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-20μg protein were loaded onto 4-20% SDS-PAGE gels (Biorad) and run at 100V ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: Frozen muscle biopsies were homogenised in modified Laemmli sample buffer as described previously.37 Samples were run in Bio-Rad Criterion 3–8 % tris-acetate gradient gels (Bio-Rad Laboratories, CA, USA) at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal amounts of protein (5–20 μg) were loaded into each lane and separated on 4–20% polyacrylamide tris glycine SDS gels (BioRad), then transferred to polyvinylideneifluoride membranes (BioRad) ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Developmental Biology 2022Quote: ... then blocked with 20 ml 5% nonfat dry milk (BioRad, cat # 170-6404) in TBS for 1 hour with rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 % glycerol was added and analyzed on a 5 % TBE gel (Bio-Rad) run in ice-cold 0.5 X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).