Labshake search
Citations for Bio-Rad :
1 - 50 of 3158 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Molecular Biology 2024Quote: ... The blots were washed again after secondary antibody incubation and developed using either nitroblue tetrazolium (NBT)–5-bromo-4-chloro-3-indolylphosphate (BCIP) for AP-conjugated secondary antibodies or the ECL substrate (BioRad) for the HRP labelled secondary antibody after incubating for about 10 to 15 mins at room temperature with gentle shaking ...
-
bioRxiv - Microbiology 2020Quote: ... nitro (Bio-Rad) and Trans-blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by ExtrAvidin alkaline phosphatase conjugate and alkaline phosphatase substrate: p-nitro blue tetrazolium chloride enhanced 5-bromo-4chloro-3-indolyl phosphate (Bio-Rad). The membranes with the transferred rgp120 were incubated with the HRP-conjugated V5 antibody (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... and transferred to the nitro-cellulose membrane (Bio-Rad) by semi-dry transfer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and transferred to the Nitro-Cellulose membrane (Bio-Rad) by semi-dry transfer (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and transferred to the Nitro-Cellulose membrane (Bio-Rad) by semi-dry transfer (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP) using Micro Bio-Spin 6 columns (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Biochemistry 2024Quote: ... and then buffer exchanged into 150 mM ammonium acetate pH 7.5 by two consecutive passes over centrifugal gel filtration columns (Micro Bio-Spin P-6, 6-kDa cut off; BioRad). Protein concentration was verified by A280 ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino- 2-phenylindole (DAPI) (1 ug/mL; Bio-Rad, Cat.# 1351303) to counterstain for confocal microscopy ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% 2- mercaptoethanol (1610710, Bio-Rad, Hercules, CA) and heated at 95°C for 5 min to denature ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM DTT and 0.5% OGNPG) on a Micro Bio-Spin 6 column (Bio-Rad) and then diluted to a concentration of 10 mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 10-30 μL of the supernatants (based on protein abundances) were run on an 8% SDS-PAGE gel and transferred to a nitro-cellulose membrane (Cat. No. 1620112, BioRad) using a semi-dry transfer method (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’ - GAT GGA GAA AGC TCT GAG CAT C -3’ Reverse: 5’ - TTG CTC CAC AGA TGG AGT TG -3’ RHAMM PrimePCR primers were obtained from BioRad (Cat#: 10025636)
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Biophysics 2022Quote: ... The protein-dye conjugate was purified by 3 rounds of size exclusion chromatography (Bio-Spin 6 column, BioRad, CA) and then aliquoted in 5 μL portions and stored at -80C until required.
-
bioRxiv - Synthetic Biology 2024Quote: The samples (1 µL) were subjected to SDS-PAGE and transferred to a nitro cellulose membrane (Bio-Rad Laboratories, CA, USA). The membrane was blocked using 3% skim milk in PBST (137 mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... The membrane was washed with the washing solution twice and then reacted with 4-chloro-1-naphthol (Bio-Rad Laboratories) in the HRP color development buffer (Bio-Rad Laboratories ...