Labshake search
Citations for Bio-Rad :
1 - 50 of 1522 citations for 2' 3' Isopropylidene Adenosine 13C5 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μL of DNAse (1:3 in DNase buffer) (Biorad, 10042051) was added to 700 ng of RNA sample ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Neuroscience 2023Quote: ... on an Opticon 2 from MJ Research with Opticon Monitor 3 software (BioRad). Reactions were set up manually using an 8-channel pipette (30-300μL ...
-
bioRxiv - Biophysics 2021Quote: ... Detergents were removed by adding 2-3 batches of Bio-beads SM2 (Bio-Rad) with constant rotation for overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... the DDM was removed by 3 additions of SM-2 bio-beads (Bio-Rad), incubated for 2h/2h/overnight ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Neuroscience 2024Quote: ... solubilisates were incubated for 2 hours with 3 µg of coupled ABs (V5, BioRad, #MCA1360) or 40 µl anti-FLAG affinity resin (Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... The embryoid media was aspirated and 15 to 20 embryoid bodies were plated per well in 6-well plates and cultured in 3 mL hematopoetic medium (2 mM GlutaMax, 1x Anti-Anti, 55 mM 2-mercaptoethanol (BioRad; Cat. No. 1610710), 100 ng/mL M-CSF ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Immunology 2020Quote: ... and detergent removed by adsorption to polystyrene BioBeads SM-2 (3 mg; Bio-Rad; overnight, 4°C). Proteoliposomes were collected by ultracentrifugation (180,000 xg ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added into (Ribosome purification: 5 mL; PURE proteins purification: 2-3 mL) Econo-Pac chromatography columns (Biorad). The column was washed with 50 mL deionized Millipore water and charged with 15 mL 0.1 N Nickel sulphate solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was washed 3 times with PBS-T and developed with ECL (Biorad170-5060) for 2 min and imaged on ChemiDocTMMP (Biorad).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were heated to 50°C for 2-3 min before addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Genomics 2021Quote: The nuclei solution were adjusted to 43°C for 3 min and melted 2% agarose from CHEF Genomic DNA Plug Kits (Bio-Rad) was added to reach a 0.82% agarose plug concentration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... which subsequently performed 2-DE using a 7 cm immobilized pH gradient (IPG) strips (pH range of 3—10, Ready strip, Bio-Rad, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: To visualize protein expression 1 μL of the TXTL reactions was mixed with 2 μL of water and 3 μL of 2x Laemmli loading dye (Bio-Rad, Hercules, CA, USA) and incubated at 90°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Neuroscience 2024Quote: ... and embedded in 3% agar (Bio-Rad). Sections were cut at 60 µm on a vibratome and mounted on slides ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...