Labshake search
Citations for Bio-Rad :
4801 - 4850 of 6467 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The products were separated on native 10% polyacrylamide gels (acrylamide: bisacrylamide 19:1, Biorad). The gels were then dried and exposed to storage phosphor screens (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 mg total) was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad) and diluted to 100 μl in ddH20 for subsequent qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 20 μL ddPCR reaction mixture contained 1× ddPCR master mix (Bio-Rad, USA), 0.9 μM primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% Tween-20 (TBS-T): Goat anti-mouse Starbright700 (1:10000, Bio-Rad,12004158), Goat anti-rabbit IRDye800 (1:10000 ...
-
bioRxiv - Genetics 2020Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad) using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Biochemistry 2021Quote: ... and monoclonal anti mouse secondary antibodies conjugated to horseradish peroxidase (1:5000, Bio-Rad). After incubation with ECL substrate (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... starting from 1 μ were designed through Beacon Designer 2.0 Software (Bio-Rad Laboratories). CLUH primers sequences were TACATCATGGGCGACTACGC (forward primer ...
-
bioRxiv - Genetics 2020Quote: ... membranes were incubated with HRP-conjugated goat-anti-mouse IgG (1:2000; Bio-Rad) for 1 h at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad), using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Neuroscience 2021Quote: ... We immunopanned RGCs from retinal suspension using Thy1.2 antibody (CD90, 1:800, Bio-RAD) and 0.02% BSA (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... and 1 ml Luminol/enhancer solution (Clarity™ Western ECL, BIORAD, Les-Ulis, France) and observed using ChemiDoc (ChemiDoc™ Imaging Systems ...
-
bioRxiv - Biophysics 2020Quote: ... Secondary antibody was goat anti-mouse IgG horseradish peroxidase conjugate (1:5,000; Bio-Rad). Blots were developed using the Luminata Forte Western HRP substrate reagent (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... was used at 1:10,000 and developed with Clarity Western ECL Substrate (Bio-Rad). mRFP1 from phagolysosomes was identified by the increased gel migration compared to native mRFP1 (Katayama et al. ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesis was performed using 1 μg of total RNA (iScript, Bio-Rad). qPCR was performed with the following gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates were boiled for 5 min in 1 x Laemmli Sample Buffer (Bio-Rad) containing 5% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μL qPCR mix contained 1× IQ™ SYBR Green Supermix (BIO-RAD), 0.25 μM of each primer and 1 μL of 1:10 diluted DNA from individual gradient fractions ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg of RNA was reverse transcribed with iScript™ reverse transcription (Biorad, 1708841). Quantitative polymerase chain reaction was performed using Sso Advanced Universal SYBR Green Supermix (Bio-Rad 1725274 ...
-
bioRxiv - Plant Biology 2023Quote: ... Samples were mounted on a glass slide with 1% low-melt agarose (Bio-Rad) and submerged in de-ionized water.
-
bioRxiv - Molecular Biology 2022Quote: ... Final elution was performed by resuspension in 1 x laemmli buffer (Bio-rad, 1610747) and heating at 90 °C for 5 minutes
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg RNA was reverse-transcribed with Iscript Supermix (Bio-rad). cDNA was then used to amplify the target genes by SYBR Green PCR Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... ChIP’ed DNA was eluted using an elution buffer containing 1% SDS (Bio-Rad, 1610418) and 0.1M NaHCO3 (Merck ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were loaded into a 1% certified low melt agarose gel (Bio-Rad, 1613112) in 0.5× TAE buffer with ladders (CHEF DNA Size Marker ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti-CD11b (Bio-Rad, #MCA711G, 1:500), and rabbit anti-Iba1 (Wako ...
-
bioRxiv - Biochemistry 2023Quote: ... and visualized using secondary anti-mouse HRP (dilution 1 to 3000, #1706516, Bio-Rad) or anti-rabbit HRP-antibodies (dilution 1 to 3000 ...
-
bioRxiv - Biochemistry 2023Quote: ... and activated for 1 min using the ChemiDoc MP Imaging system (Bio-Rad Laboratories). Activated protein was transferred to a PVDF membrane (ED Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rat anti-CD11B (1:100; #MCA711G Bio-Rad), rabbit anti-IBA-1 (1:100 ...
-
bioRxiv - Microbiology 2023Quote: ... The resin-lysate mixture was poured into a 1-cm separation column (Bio-Rad), the resin was allowed to pack ...
-
bioRxiv - Immunology 2023Quote: ... Sections were incubated with an anti-F4/80 antibody (1:100 dilution, Bio-Rad, cat ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature using ECL solution Clarity Max (Bio-Rad Laboratories) and fluorescence-imaging device (Vilber ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 1 hour at 37 °C before resolved on 10% TBE PAGE gels (BioRad) run at 100 volts for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... cell pellet was gently resuspended in 200 μL of 1 X Laemmli Buffer (Biorad) supplemented with β-mercaptoethanol at a final concentration of 2.5 % ...
-
bioRxiv - Microbiology 2022Quote: ... at 10 V for 1 hr using Trans-Blot Turbo Transfer System (Bio-Rad). Then ...
-
bioRxiv - Systems Biology 2022Quote: ... StarBright Blue 700 goat anti-mouse IgG (catalog number 12004159; Bio-Rad; 1:10,000), rabbit anti-goat immunoglobulins/HRP (catalog number P0449 ...
-
bioRxiv - Biophysics 2023Quote: ... The purity of 12mer arrays was confirmed using APAGE (2% acrylamide, 1% Biorad agarose) gels stained with SyBr Gold (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... membranes were incubated with 1:5000 HPRT-conjugated anti-mouse secondary antibody (Biorad, 1706516) for 1 h at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... membranes were incubated in secondary goat anti rabbit antibody (1:10000, Bio-Rad, 1706515) for one hour ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by horseradish peroxidase-conjugated Goat- anti-mouse second antibodies (1:10000; BioRad # 1721011) for 1hr at the room temperature.
-
bioRxiv - Cancer Biology 2024Quote: ... at 1:10,000 and goat anti-rabbit HRP-conjugated (1721019, Bio-Rad, RRID: AB_11125143) at 1:10,000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP signal was detected in 9:1 mix of Clarity:Clarity Max ECl reagent (BioRad) and captured using a Chemidoc Touch imager (BioRad).
-
bioRxiv - Developmental Biology 2023Quote: ... and secondary antibodies HRP-conjugated goat anti-mouse IgG (1:5000; 1706516, Bio-Rad) or goat anti-rabbit IgG (1:5000 ...
-
bioRxiv - Genetics 2024Quote: ... The primary antibodies (NF-kB, #8242 Cell Signaling, 1:1000; CD3, MCA-1477 Biorad, 1:100 ...
-
bioRxiv - Genetics 2024Quote: ... goat anti-mouse IgG (H+L) HRP conjugate (1:10000, Bio-Rad Cat. # 1706516).
-
bioRxiv - Cell Biology 2023Quote: ... and goat anti-mouse IgG (H+L)-HRP conjugate (170-6516, Biorad, 1:10000). Antibody binding was detected by the enhanced chemiluminescence system (Thermo Fischer Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... 2× ddPCR supermix for probes (no dUTP) final concentration 1× (Bio-Rad Laboratories, USA), a 20× target primer/FAM-labeled probe mix ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 1 μg was boiled for 10 min in 1x Laemmli Sample Buffer (BioRad) with 5% 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibody used was goat anti-rabbit-HRP (1:5000, Bio-Rad, 170-6515). Ponceau-S red staining was used for mESCs samples as a loading control.
-
bioRxiv - Cell Biology 2024Quote: ... RNA (1 μg) was reverse transcribed using iScript™ cDNA Synthesis Kit (Bio-Rad), and PCR was performed using Q5® High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... either goat anti-mouse coupled with DyLight®800 (Bio-Rad, 1:10000 dilution) or goat anti-rabbit coupled with StarBright Blue 700 (Bio-rad ...