Labshake search
Citations for Bio-Rad :
4751 - 4800 of 7697 citations for 6 Pteridinepropanoic acid 2 4 diamino α 4 methoxycarbonyl phenyl α 2 propyn 1 yl methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... and subsequently purified using Micro Bio-Spin P-6 gel columns (Bio-Rad 7326221). The BG-oligos were then conjugated to SNAP-proteins by mixing at a 2:1 molar ratio in storage buffer (20 mM HEPES [pH 7.5] ...
-
bioRxiv - Molecular Biology 2019Quote: ... Gel exclusion chromatography on Bio-Gel P-6 acrylamide resin (Bio-Rad #150-0740) in renaturation and storage buffer RN#5 (0.1 M NaH2PO4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 6-well plates were imaged using a chemidoc (Bio-Rad, Hercules, CA, USA) and the number of colonies was counted in CellProfiler using an automated analysis pipeline ...
-
bioRxiv - Cancer Biology 2020Quote: ... Products were resolved via 6% PAGE and imaged using a ChemiDoc XRS (Bio-Rad). The percent spliced in (PSI ...
-
bioRxiv - Biophysics 2021Quote: ... Free dye was removed by Micro Bio-Spin 6 Columns (Bio-Rad Laboratories, 7326222).
-
bioRxiv - Genetics 2019Quote: ... Transcribed RNAs were then purified by micro Bio-Spin 6 chromatography columns (Bio-rad) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Unquenched periodate was removed using Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... or homemade 6-15% SDS-PAGE gels and transferred to a nitrocellulose membrane (Biorad). The membrane was blocked in 10% non-fat dry milk in TBS-T and stained with primary antibody overnight at 4°C or 2-3 hours at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The reaction was cleaned up by P-6 Micro Bio-Spin Column (Bio-Rad). For fluorophore labeling ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... The 10 µl reactions were purified with Bio-Spin® 6 Columns (Bio-Rad), and mixed with 10 µl of RNA loading dye (95% formamide ...
-
bioRxiv - Biophysics 2023Quote: ... pH 7.5 using a Micro Bio-Spin™ 6 column (Bio-Rad 732-6221). The compound of interest (5 μM ...
-
bioRxiv - Biophysics 2023Quote: ... with free dye removed using a Bio-Spin P-6 gel column (BioRad, 7326227) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad), added to 445 μL Sonication buffer (20 mM Tris-HCl pH7.5 ...
-
bioRxiv - Biochemistry 2023Quote: ... Free nucleotides were removed with BioRad Micro Bio-Spin 6 gel columns (BioRad 7326222) equilibrated to BRB80 buffer according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Aortic root sections (6 µm) were stained for CD68 (Bio-Rad MCA1957; Hercules, CA) to detect macrophages ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Aortic root sections (6 µm) were stained for CD68 (Bio-Rad MCA1957; Hercules, CA) to detect macrophages ...
-
bioRxiv - Biophysics 2021Quote: ... The soluble fraction was loaded onto a nickel-nitrilotriacetic acid column (Bio-Rad, Hercules, CA) and proteins were purified following the manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: ... organic acids and glycerol were measured using an HPX-87H column (Bio-Rad, CA, USA) at 45°C ...
-
bioRxiv - Immunology 2020Quote: ... Protein concentrations were measured after sonication by the bicinchoninic acid assay (Bio-Rad, Hercules, CA), and equal amounts of fragmented chromatin–protein complexes were incubated for 2 h with enclosed Dynabeads coupled to rabbit anti-Polβ (Ab26343 ...
-
bioRxiv - Physiology 2019Quote: ... Protein concentration of the supernatant was measured with bicinchoninic acid assay (BCA) kit (Bio-Rad) followed by normalization of proteins via the addition of 1x passive lysis buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The adaptor was cleaned up on a Micro Bio-Spin 6 chromatography column (Bio-Rad) equilibrated with water ...
-
bioRxiv - Microbiology 2019Quote: ... Excess [γ-32P] ATP was removed with a Bio-Spin 6 column (Bio-rad, CITY). Followed by heat inactivation ...
-
bioRxiv - Biochemistry 2022Quote: ... with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad). The protein concentration and purity were verified by Bradford Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... 10mM BME) at room temperature using Micro Bio-Spin 6 columns (Bio-Rad CAT# 7326200). PARLSkd3 concentration was measured via A280 and the molar extinction coefficient and PARLSkd3 concentration was adjusted to 30 μM ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 6 μl freshly prepared Ammonium persulfate (Bio-Rad, 10 mg in 100μl distilled water) were added to the solution and mixed ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10 μg of protein was loaded onto an acrylamide gel (6–15%; Bio-Rad). Gel electrophoresis was performed in Tris- glycine-sodium dodecyl sulfate (SDS ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Biochemistry 2024Quote: ... A transfer sandwich was constructed using 6 transfer buffer-soaked blotter papers (#1704085, BIO-RAD) (Fig ...
-
bioRxiv - Cancer Biology 2020Quote: ... lysate concentrations were adjusted to equal protein concentrations using the bicinchoninic acid (BCA) protein assay (Biorad). Equal amounts of protein were mixed to a final concentration of 1x reducing sample buffer (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... boric acid) Urea solutions were made fresh daily and incubated with AG 501-X8 resin (Biorad) for minimum 5 hours to remove ionic contaminants ...
-
bioRxiv - Microbiology 2022Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm; Bio-Rad, Hercules, CA, USA) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Biochemistry 2019Quote: The acetic acid was quantified using an Aminex HPX-87H (300 x 7.8 mm, Bio-Rad) column with a Carbo-H precolumn (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: Nucleic acids (RNA or DNA) samples were loaded in Bio-Dot SF Microfiltration Apparatus (Bio-Rad) and allowed to bind onto the membrane ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...