Labshake search
Citations for Bio-Rad :
401 - 450 of 6487 citations for Oxytocin Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: 96-well PCR plate (Biorad, HSP9631)
-
bioRxiv - Synthetic Biology 2024Quote: ... Plates were sealed (Bio-Rad MSB1001) and both sfGFP fluorescence (emission/excitation ...
-
bioRxiv - Immunology 2024Quote: ... Microseal ‘B’ plate sealers (Bio-Rad) and iTaq Universal Probes Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Genetics 2023Quote: ... Plate Sealing Film (Bio-Rad, MSB1001) and Bio-Rad C1000 Touch Thermal Cycler were used for qPCR experiments ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Aliquots of the samples were organized in a 96well PCR plate and reverse transcribed to cDNA using the iScriptTM Reverse Transcription Supermix kit and protocol (BioRad; Hercules, CA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary antibody was washed away 5× with TBS-T and developed with an AP Conjugate Substrate Kit (Bio-Rad). Spots were quantified using a Nikon ELISPOT system and NIS-Elements AR software (v ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the protein concentrations of the supernatants were determined using DC™ Protein Assay Kit (Bio-Rad #5 000 112). Equal concentrations of protein (30 μg ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were immunoprobed using an HRP-conjugated secondary antibody (dilution 1:3000) and chemiluminescent substrate (Clarity Western ECL substrate, Bio-Rad, Hercules, CA, USA). Blot image acquisition was performed using a Molecular Imager® Gel Doc™ XR+ system (Bio-Rad ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein levels were quantified with ImageLab software after acquisition of chemiluminescent signals with a Chemidoc digital imager (Bio-Rad, Marnes-la-Coquette, France). For all SDS-PAGE analyses ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots were developed using the SuperSignal West Pico chemiluminescent substrate (Pierce,ThermoScientific) and analyzed using the ChemiDoc XRS + imagingsystem (Bio-Rad, http://www.bio-rad.com/). Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2024Quote: ... The blots were developed using the Luminata Forte Western Chemiluminescent HRP Substrate (MilliporeSigma, Burlington, MA, USA) and visualized on a ChemiDoc Imaging System (Bio-Rad, Hercules, CA, USA). Densitometry analysis was performed using Image Lab software version 6.0 (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein bands of interest were detected using a chemiluminescent reagent (luminol, p-coumaric acid, and hydrogen peroxide) and a ChemiDoc system (Bio-Rad, Hercules, CA, USA). Densitometric analysis was performed using ImageJ software v1.53 (National Institute of Health ...
-
bioRxiv - Biophysics 2019Quote: ... the resulting formazan dye was quantitated with a scanning multi-well plate spectrophotometer (Biorad iMark plate reader). The absorbance directly correlates to the number of viable cells ...
-
bioRxiv - Microbiology 2022Quote: ... and transferred into a 96-well PCR plate (heat-sealed with a foil plate seal, Bio-Rad). PCR was carried out in a C1000 thermal cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... thin walled plates 384-well PCR Plate (ABgene 12164142) by using SYBR Green Supermix (Biorad, 172-5124), 10% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The plates were washed using a 96-well plate magnetic handheld washer from Bio-Rad (NSW, Australia). The Bio-Plex Manager 3.0 software was used to operate the system and interpret the data.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification reactions of each DNA sample were performed in PCR plates (hard-shell PCR plate, #HSP9645; Bio-Rad), in a volume of 25 μl containing 12.5 μl PCR buffer (HotstarTaq mastermix ...
-
bioRxiv - Cell Biology 2022Quote: ... Up to 5 μg of total RNA was reverse transcribed into cDNA using iScriptTM Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad). Quantitative real time-PCR was performed using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysates were sonicated with a microtip for 5 sec at 20% amplitude and quantitated in DC Protein Assay kit II (BioRad, 5000112) against a BSA standard curve ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription (RT) was performed from 2 to 5 µg of RNA with iScript Adv cDNA synthesis kit (Bio-Rad #1725038). The cDNA was diluted 5 times and 1 μL of this was used for each reaction in real-time PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... In this assay chemiluminescent reagent was used and the image of spots was captured using a Flour-S Max Multi-imager (Bio-Rad Laboratories, Hercules, CA, USA), and the spot density was determined with Quantity One Software (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... Bio-Dot SF Microfiltration Apparatus plates (BioRad) were used to transfer the protein samples onto the nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2021Quote: ... in 96 well PCR plates (Bio-Rad) on a CFX96 Touch Real Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... in 96-well reaction plates (Bio-Rad). For pS6- and Sst-TRAP experiments ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were imaged using a ChemiDoc (Biorad).
-
bioRxiv - Immunology 2023Quote: ... plates were placed in a thermocycler (BioRAD), where it is heated to 65 °C for 2min and cooled to 10 °C for 5min ...
-
bioRxiv - Biochemistry 2023Quote: ... In a qPCR plate (Bio-Rad MLL9601), 1 µL of cDNA was dispensed ...
-
bioRxiv - Plant Biology 2023Quote: In a 96-well qPCR plate (Biorad), 5 µL of 10 µM total protein of sfGFP1-10 Ni-NTA eluate in storage buffer (10mM Tris ...
-
bioRxiv - Immunology 2023Quote: ... Plates were placed in a thermocycler (BioRAD) with the following program ...
-
bioRxiv - Neuroscience 2023Quote: ... sealed with PX1 PCR plate sealer (BioRad) and cycled in a T100 Thermal Cycler (BioRad ...
-
bioRxiv - Plant Biology 2023Quote: ... with hard-shell-96 well plates (BIORAD). Each reaction was carried out with 4 μL master mix (Titan HotTaq EvaGreen ...
-
bioRxiv - Immunology 2024Quote: ... with 96-well plates (Bio-Rad Laboratories), Microseal ‘B’ plate sealers (Bio-Rad ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... followed by measuring the absorbance of individual wells at 450 nm using an ELISA reader (Bio-rad mod.550). Serum samples from unmanipualted mice were used for negative controls.
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR plate was subsequently heat-sealed with pierceable foil using a PX1™ PCR plate sealer (Bio-Rad) and then amplified in a LifeEco thermal cycler (Bioer ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR plate was subsequently heat-sealed with pierceable foil using a PX1 PCR plate sealer (Bio-Rad, USA) and then amplified in a Veriti thermal cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... Droplets were transferred to a 96-well PCR plate and heat-sealed using PX1 PCR Plate Sealer (Bio-Rad). PCR amplification was performed with the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... the OD600 of the 96-well plate was recorded by a plate reader (iMarkTM microplate absorbance reader, Bio-Rad). The minimum inhibitory concentration (MIC ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...