Labshake search
Citations for Bio-Rad :
401 - 450 of 5356 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 2×Laemmli buffer (Bio-Rad Laboratories) supplemented with β-mercaptoethanol was added to the beads ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 µM 2-mercaptoethanol (Bio-Rad), DMEM/F-12 (Invitrogen) ...
-
bioRxiv - Biophysics 2020Quote: Bio-Beads SM-2 (Bio-Rad) were prepared ∼400 uL biobeads ...
-
Peripheral neuropathy linked mRNA export factor GANP reshapes gene regulation in human motor neuronsbioRxiv - Neuroscience 2021Quote: ... in 2-mercaptoethanol (#1610710, Bio-Rad). Gel was transferred into a nitrocellulose membrane (#1704158 ...
-
bioRxiv - Biochemistry 2020Quote: ... BioBeads SM-2 (Bio-Rad Laboratories) in the amount of 0.6 g per 1 mL were added to the reconstruction mixture and the resulted mixes were incubated for 2 hours at 4°C for DMPC nanodiscs and 4 hours at 4°C for POPG and DMPC:POPG (50:50 ...
-
bioRxiv - Bioengineering 2021Quote: ... and 2% bis-acrylamide (BioRad 1610143) solutions were diluted in ultrapure water at varying concentrations to yield hydrogels of varying stiffness ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-mercaptoethanol (Bio-Rad, 1610710). Lysates were resolved on SDS polyacrylamide gels and blotted onto PVDF membranes using Trans-Blot Turbo RTA Midi 0.45 μm LF PVDF Transfer Kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 2-merchatoethanol (#1610710, Bio-Rad) and boiling at 95°C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-Mercaptoethanol (BioRad, cat # 1610710) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µL propidium iodide (BioRad, 1351101) was added to the single-cell suspension and sorting was performed on the PI-negative live cell population using fluorescent-activated cell sorting (FACS) ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Cell Biology 2024Quote: ... and 2% Bis-Acrylamide (Bio-Rad) with milliQ water as described elsewhere 38 ...
-
bioRxiv - Biochemistry 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were activated with methanol ...
-
bioRxiv - Cell Biology 2023Quote: ... 66 µl 2% bisacrylamide (Bio-Rad), 334 µl water for a final concentration of 12.5% acrylamide and 3.75% bisacrylamide in water ...
-
bioRxiv - Bioengineering 2024Quote: ... 2% Bis-Acrylamide solution (BIORAD, #1610142), and distilled water was blended and adjusted to manufacture PA gels with varying rigidity ...
-
bioRxiv - Biochemistry 2022Quote: ... Biobeads SM-2 resin (Bio-Rad) was added at a ratio of 1:5 (w/v) ...
-
bioRxiv - Immunology 2022Quote: ... and SM-2 beads (Bio-Rad) as previously described (9) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... with 2-mercaptoethanol (BIO-RAD, 1610710) was added to the samples which were heated (95°C ...
-
bioRxiv - Biophysics 2023Quote: ... and bis-acrylamide (2% solution, BioRad) were polymerized by addition of 0.1%(v/v ...
-
bioRxiv - Immunology 2023Quote: ... Kallestad HEp-2 slides (BIO-RAD) were stained overnight with 1µL of serum from either Lyn-/-IgD+/- or wildtype mice ...
-
bioRxiv - Biophysics 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were added to the mixture ...
-
bioRxiv - Biochemistry 2024Quote: ... Bio-Beads SM-2 (BIO-RAD) where added to the mixture to remove detergent ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10% 2-Mercaptoethanol (Bio-Rad). After boiling at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... After three washes (5, 10, 15 minutes) the blot was incubated for 60 minutes with secondary Goat Anti-Rabbit-HRP (Bio-Rad, 1:7000) and Alexa 647 Goat-Anti-Mouse antibodies (Molecular Probes ...
-
bioRxiv - Cell Biology 2020Quote: ... transferred to 0.2 μm pore-size PVDF membranes, and blocked for 1 hour in blocking buffer (5% milk, 0.1% Tween-20 in 1x TBS (Bio-Rad, Hercules, CA, USA)) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Cell Biology 2022Quote: ... Then membranes were washed 3 times with TBS-T and incubated with goat anti-mouse or anti-rabbit IgG HRP-conjugated secondary antibody (1:10000 in 5% BSA TBS-T, Bio-rad; #1706515, #1706516) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... in 1× TBS for 5–10 min at room temperature to visualize DNA and mounted with FluoroGuard anti-fade reagent (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2023Quote: ... Mixed samples were immediately centrifuged at 200 x g for 5 mins and 20 μl of the supernatant was transferred into 1 ml Bradford reagent (Bio-Rad, CA, USA) in 1.5 ml tubes ...
-
bioRxiv - Cell Biology 2024Quote: A total of 10 µg of protein was combined with 5 µL of Laemmli buffer (1:9 β-mercaptoethanol [PCS 1610710, Bio-Rad] to Laemmli sample buffer [PCS 161-0737, Bio-Rad]) and sufficient water to reach a final volume of 20 µL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...