Labshake search
Citations for Bio-Rad :
401 - 450 of 10000+ citations for GA binding protein alpha chain GABPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The AMR genotypes of transconjugant colonies were determined by polymerase chain reaction (PCR) assays on a T100™ Thermal Cycler (Bio-Rad, Hercules, CA). Reaction volumes were 25 µL and consisted of 12.5 µL of Accustart II PCR Toughmix (Quantabio ...
-
bioRxiv - Cell Biology 2023Quote: ... were removed from the eluted samples post-purification and quantified using quantitative Real Time polymerase chain reaction using the Bio-Rad CFX 96™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA) and Promega Plexor®HY Quantitation System (Promega Corporation ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time quantitative polymerase chain reactions (RT-qPCR) were performed in 10 μl reactions containing Power SYBER Green PCR master mix (Bio-Rad; Cat #: 172-5121), 5 ng of cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein (Bio-Rad) was determined on 25µl of the extract.
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration was determined by BioRad Protein Assay (BioRad) and 20 ug protein was resolved by SDS-PAGE in 10% acrylamide gels ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein ladder (BIORAD Dual-Colored Prestained Protein Standard ...
-
bioRxiv - Physiology 2020Quote: ... Bradford protein assay kit as well as anti-mouse and anti-rabbit secondary antibodies were obtained from Bio-Rad (Hercules, CA). Antibodies against ERα (F-10 mouse – for WB) ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates of WT OSC were incubated with 1μg of Rabbit anti-Piwi polyclonal antibody (18) and 30 μl Surebeads Protein A Magnetic beads (Bio-Rad, 1614013). Immunoprecipitation was performed at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Equal amounts of proteins (20–100μg as optimal for each antibody) for each sample was loaded into 4-15% Mini-PROTEAN TGX Stain-Free Protein Gels (BioRad; #4568084) for electrophoresis ...
-
bioRxiv - Neuroscience 2023Quote: ... The secondary antibody was washed away with PBS-T and stained proteins were detected by chemiluminescence (Clarity western ECL, Bio-rad). The western blot signal was acquired using Amersham Image Quant8000.
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were visualized using horseradish-peroxidase-conjugated secondary antibodies followed by chemiluminescence detection with ECL (Clarity Western ECL substrate, Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... The seeds were concentrated by immunoprecipitation after labelling by a C-20 antibody and precipitation with protein A-conjugated magnet beads (Bio-Rad), and then eluted by the SDS sample buffer at 56°C for 15 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes were then washed with TBST and incubated with HRP-conjugated secondary antibodies for one hour before immunoreactive protein bands were visualized using enhanced chemiluminescence (ECL) reagent (Bio-Rad) and captured by Bio-Rad ChemiDoc Imaging System ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 15-well Mini Protein Gel with a Precision Plus Protein™ All Blue Prestained Protein Standard (Bio-Rad) and run for 16 min at 200 V ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein purity was analyzed via SDS-PAGE and protein concentration was measured using Bradford (Bio-Rad protein assay). GST-Rap2a Lysine mutants (K2R ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentrations were measured using bovine serum albumin for the protein standard and protein assay dye (Bio-Rad). A total of 40 μg of protein per condition was denatured with SDS-PAGE sample buffer and then loaded into polyacrylamide SDS-PAGE gels ...
-
bioRxiv - Physiology 2022Quote: ... The protein concentration in the cell lysate was determined using protein assay (DC Protein Assay, Biorad, Hercules, CA). Samples were adjusted to the same concentration with buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... protein concentrations were determined using the Bio-Rad Protein Assay Kit (Bio-Rad protein assay Dye reagent concentrates). Samples were counterbalanced by sex and drinking history across gels for Western-Blot ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were separated along with 5 µl Precision Plus Protein All Blue Prestained Protein Standards (Bio-Rad, 1610373) at 80-120 V in SDS-PAGE running buffer containing 25 mM Tris ...
-
bioRxiv - Neuroscience 2023Quote: ... total protein concentration was measured using a protein assay (DC™ Protein Assay Kit II, BIO-RAD, 5000112). Activin A measurements were normalized to total protein levels ...
-
bioRxiv - Cell Biology 2023Quote: ... the supernatant protein extract was collected and protein concentration was determined using DC Protein Assay Kit (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... Each amount of protein was loaded into 8-16% Mini-PROTEIN TGX Precast Protein Gels (Bio-Rad, #4561106) and then transferred to Trans-Blot Turbo Mini 0.2 µm PVDF Transfer Packs (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... serially diluted rabbit serum (5-fold dilution starting with 1:80) were tested for binding to color-coded beads by Bio-plex (Biorad). The beads were coated with avi tagged C.1086 WT ...
-
bioRxiv - Microbiology 2020Quote: Steady-state equilibrium binding of post-vaccination rabbit polyclonal serum was monitored at 25°C using a ProteOn surface plasmon resonance (BioRad). The purified recombinant Spike proteins were captured to a Ni-NTA sensor chip with 200 resonance units (RU ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: Steady-state equilibrium binding of hCoV-2IG lots was monitored at 25°C using a ProteOn surface plasmon resonance (BioRad). The purified recombinant SARS-CoV-2 RBD proteins were captured to a Ni-NTA sensor chip with 200 resonance units (RU ...
-
bioRxiv - Genetics 2023Quote: ... Differential binding was assessed by densitometry analysis of photostimulated luminescence (PSL) using Molecular Imager PharosFX System (Bio-Rad, #170-9450) and Quantity One 1-D analysis software (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL-12 (10 ng/mL)] or transferred to a high-binding 96-well plate pre-coated with indicated amounts of control or TAG72 antigen (BioRad). Reagents and buffers for flow cytometry processing were pre-chilled on ice unless otherwise stated ...
-
bioRxiv - Molecular Biology 2024Quote: ... binding was revealed with an enhanced chemiluminescence detection kit (1705062; Clarity Max Western ECL Substrate; BIORAD, Marnes-la-Coquette, France). Membranes were imaged on a ChemiDoc™ system (BIORAD ...
-
bioRxiv - Cancer Biology 2024Quote: ... secondary antibodies were incubated with the membrane before binding was visualised using EZ-ECL (Biological Industries, 20-500-120) and imaging on a ChemiDoc Imaging System (BioRad) [38].
-
bioRxiv - Cancer Biology 2021Quote: ... and protein concentrations were calculated using a BCA protein assay (BioRad). After denaturation with Laemmli buffer (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein amounts were quantified using Biorad Protein Assay (Biorad #500-0006) and a bovine serum albumin standard curve (Biorad #500-0007 ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein content was quantified by the DC protein assay (Bio-Rad) with known concentrations of BSA as standards ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were determined using the DC Protein Assay (BioRad 5000111) and 20 µg total protein was denatured for 5 min at 70°C in 1X Laemmli Buffer (Sigma Cat # S3401-10VL) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined by the Bradford Protein Assay (Bio-Rad). Western blots were carried out using secondary antibody (Immunopure goat anti-mouse ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentrations were determined by the Bradford protein assay (Bio-Rad) or bicinchoninic acid (BCA ...
-
bioRxiv - Developmental Biology 2020Quote: ... After measuring the protein concentration with DC protein Assay (Bio-Rad), 25 μg of total protein was loaded into the well on ELISA plate ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were separated on 4-15 % precast protein gels (Bio-Rad) and transferred onto PVDF membranes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein content was determined using DC Protein Assay (5000112, Biorad) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Equal amounts of supernatant proteins (determined by Bio-Rad protein assay) were fractionated by SDS-PAGE and analyzed by immunoblotting.
-
bioRxiv - Molecular Biology 2020Quote: ... Protein quantification was performed using the DC Protein assay (Bio-Rad). 40μg of protein was run on NuPAGE 4-12% Bis-Tris protein gel (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sample protein concentration was determined by Bradford Protein Assay (Bio-Rad) and A595 readings were measured in a DU 730 UV-Vis Spectrophotometer (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were quantified using the DC Protein Assay (Bio-Rad), following manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein concentration was determined using the DC protein assay kit (Biorad). Equal amounts of proteins (10-30ug ...
-
bioRxiv - Pathology 2021Quote: ... Protein concentration was measured by DC protein assay (BioRad, 500-0112), and 5 mM β-mercaptoethanol was added to the samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein concentration was measured using Protein Assay Dye (BioRad #500-0006) in comparison to a BSA (NEB B9000S ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentrations were determined by Bradford protein assay (#5000006, Bio-Rad). Relative protein contents in the muscles were calculated after normalizing by total amount of DNA.
-
bioRxiv - Pathology 2021Quote: ... Protein concentration was determined by a DC Lowry protein assay (BioRad).
-
bioRxiv - Cancer Biology 2021Quote: ... and protein quantified using the DC protein assay (Bio-Rad: 5000111). Derived metabolite data was normalized to protein concentration and median ion intensity per injection across the dataset.