Labshake search
Citations for Bio-Rad :
401 - 422 of 422 citations for Dnp pro leu gly cys me his ala D arg nh2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Visualisation and quantification were carried out using a Personal Molecular Imager with Quantity One 1-D analysis software (Bio-Rad) and data were analyzed with GraphPad Prism 4 software.
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... 40S and 80S fractions were quantified using Quantity One 1-D Analysis Software v.4.1.2 (Bio-Rad Laboratories, Hercules, CA). Pno1 was quantified using ImageJ Software v1.52 (100 ...
-
bioRxiv - Biochemistry 2021Quote: ... Melting temperature was determined from the region of maximal slope as visualized by the first derivative of fluorescence with respect to temperature (minimal-d(RFU)/dT) per default behavior of Bio-Rad CFX manager software (BioRad).
-
bioRxiv - Biochemistry 2023Quote: ... 2mM DTT and 0.02% n-dodecyl-β-D-maltopyranoside [DDM]) buffer after transferring into Econo columns (Biorad, Cat. no. 7372512). Thrombin at concentration 1unit µL-1 was added to the resin slurry at 1:1 (dry resin:cleavage buffer ...
-
bioRxiv - Immunology 2024Quote: ... and RANTES/CCL5 (R&D Biotechne) according to the manufacturer’s protocol and analyzed using the Bio-Plex 200 platform (Bio-rad). Analyte concentrations were calculated using a standard curve (5 PL regression ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (15 μg) were loaded on 4-15% 1 D polyacrylamide Mini-PROTEAN TGX Stain-Free gels (BioRad) and run in 1X Tris Glycine SDS buffer (BioRad ...
-
bioRxiv - Biophysics 2024Quote: Claudins purified as described above were exchanged from DDM to 2,2-didecylpropane-1,3-bis-β-D-maltopyranoside (LMNG) detergent via a PD-10 column (Bio-Rad). COP-1 was added in 1.4 moles excess to claudins then 1.4 moles excess Nb to COP-1 were mixed and incubated at 4°C for 1 hour ...
-
bioRxiv - Molecular Biology 2021Quote: ... Digitalized images of the destained SDS-PAGEs were analyzed by the Quantity One 1-D Analysis Software (Bio-Rad, Berkeley, US) to measure the band densities at each lane of all biological replicates ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized using oligo-d(T) primers and avian reverse transcriptase (iScript cDNA Synthesis Kit, Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... as well as the level of cytokines in mouse serum, were assessed by using customized plates (Luminex assay, R&D) and analyzed on a Bio-Plex 200 instrument (Bio-Rad).
-
bioRxiv - Plant Biology 2022Quote: ... Infiltrated leaves were infiltrated with 100 µM D-luciferin and LUC activity was quantified after 48 h using a low-light CCD imaging apparatus (Bio-Rad).
-
bioRxiv - Immunology 2024Quote: ... A horseradish peroxidase-conjugated secondary anti-mouse antibody (#HAF007, R&D) was applied and signals detected with a chemiluminescent HRP substrate using ChemiDocTM XR (Bio-Rad). Images were acquired using ImageLabTM software (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... for two hours at RT with mild rotation and proteins in FhNEJ-Som were acetone-precipitated using the ReadyPrep 2-D Cleanup kit (BioRad, #1632130) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Colonization of SEΔΔΔ was quantified by dilution plating and counting colony forming units (CFU) on SASelect plates supplemented with 100 μg/mL D-alanine (BioRad, Hercules, CA). All experiments were done in triplicate.
-
bioRxiv - Biochemistry 2021Quote: ... The purified proteins were running in 2-D gel electrophoresis and images were taken and analyzed in gel dock(Bio-Rad, USA). The details of protein purification protocols like TCA/Acetone ...
-
bioRxiv - Neuroscience 2022Quote: ... while brain cytokine analyses for Studies C and D were conducted using a custom 10-plex Bioplex (Bio-rad Laboratories, Hercules, CA) as previously described (Finnell ...
-
bioRxiv - Microbiology 2021Quote: ... 1:5000; # HAF017, R&D Systems, goat anti-rabbit, 1:5000; #170-6515, Bio Rad, goat anti-mouse, 1:5000; #6516, Bio-Rad). To ensure that equal amounts of proteins were loaded ...
-
bioRxiv - Molecular Biology 2023Quote: ... and optic density of the bands corresponding to mouse PRM1 and PRM2 was quantified using Quantity One 1-D analysis software (BioRad, Hercules, CA, USA) to calculate the PRM1/PRM2 ratio ...
-
bioRxiv - Immunology 2023Quote: ... Cytokine levels in cell culture supernatants was determined using the Magnetic Luminex Performance Assay (Human Base Kit A; R&D Systems, coupled with the Bio-Plex 200 (Bio-Rad). The trimmed median value was used to derive the standard curve and calculate sample concentrations.
-
bioRxiv - Molecular Biology 2021Quote: Total protein was extracted from SSLs using 350 μL of RIPA buffer and was purified using the Ready Prep 2-D cleanup kit (Bio-Rad, Hercules, CA, USA); the protein concentration was measured using the BCA protein assay kit (Thermo Fisher Scientific) ...