Labshake search
Citations for Bio-Rad :
401 - 450 of 6500 citations for Cyclic AMP Direct Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... in either 96 well plates or 384 well plates using either CFX 96 (Bio-Rad) or CFX Opus 384 (Bio-Rad ...
-
bioRxiv - Systems Biology 2022Quote: ... Drugs were then added to the plates and protein was harvested after 2 hours using the Bio-Plex Pro Cell Signaling Reagent Kit (BioRad 171304006M) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Images were acquired by developing with SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Fischer) and detected via ChemiDoc™ Touch Imaging System (Bio-Rad).
-
bioRxiv - Immunology 2020Quote: ... Membranes were incubated with enhanced chemiluminescent (ECL) reagents and bands were visualized using a ChemiDoc MP Imaging System with Image Lab Software (Bio-Rad, Hercules, CA).
-
bioRxiv - Biochemistry 2020Quote: ... Membranes were washed five times in TBS-T before detection with chemiluminescent HRP substrate (Immobilon, P90720) and imaged on a ChemiDoc™ XRS+ system (Bio-Rad, 1708265).
-
bioRxiv - Immunology 2022Quote: ... The development was performed with West Pico PLUS Chemiluminescent Substrate (Thermo, Darmstadt, Germany) with an imaging system from bio-rad (Bio-rad, Feldkirchen, Germany).
-
bioRxiv - Cancer Biology 2020Quote: ... and α-TUBULIN (1:4000) were detected using SuperSignal™ West Pico or West Femto Chemiluminescent Substrate chemiluminescence in ChemiDoc MP imaging system (BioRad, Berkeley, USA). The densitometry analyses were performed using Bio-Lab Software ...
-
bioRxiv - Cell Biology 2022Quote: ... Blots were visualized with SuperSignal™ West Pico PLUS or Femto Chemiluminescent Substrate solution (Thermo Fischer) or with Clarity™ Western ECL solution (BIO-RAD) and scanned on Fusion FX7 imaging system (Witec AG).
-
bioRxiv - Cell Biology 2023Quote: ... membranes were labelled with Supersignal West Femto Chemiluminescent Substrate (Pierce Biotechnology, Rockford, Illinois, USA) and imaged using the ChemiDoc XRS (Biorad, Hercules, CA, USA). The final protein bands were quantified using ImageLab Software (Biorad ...
-
bioRxiv - Neuroscience 2023Quote: ... The biotin end-labeled DNA was detected using a streptavidin-horseradish peroxidase combination and a light shift chemiluminescent substrate and then exposed membrane to the ChemiDoc Touch Image system (Bio-Rad, Hercules, California) as like western blots did.
-
bioRxiv - Neuroscience 2020Quote: ... Thin-wall PCR plates (#HSP9601) and Microseal optical plate covers (#MSB1001) were from BioRad (Hercules, CA). Trizol Reagent (#15596026 ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR reactions were undertaken in 96-well optical reaction plates (Bio-Rad Hard Shell PCR Plates). A 20 µl PCR reaction was set up in each well using the SYBR PowerUp Green Master Mix (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... the plate was immediately placed in a plate reader at 30°C (xMark-Microplate; Bio-Rad), and after 30 s of linear agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... using PX1 PCR plate sealer (BioRad). The optimized PCR thermal cycling was conducted on a conventional PCR machine (BioRad ...
-
bioRxiv - Neuroscience 2020Quote: ... using 96 well plates (Bio-Rad). The amplification started with an initial denaturation step at 95°C for 5 min ...
-
bioRxiv - Bioengineering 2022Quote: 96-well PCR plate (Biorad, HSP9631)
-
bioRxiv - Synthetic Biology 2024Quote: ... Plates were sealed (Bio-Rad MSB1001) and both sfGFP fluorescence (emission/excitation ...
-
bioRxiv - Immunology 2024Quote: ... Microseal ‘B’ plate sealers (Bio-Rad) and iTaq Universal Probes Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Genetics 2023Quote: ... Plate Sealing Film (Bio-Rad, MSB1001) and Bio-Rad C1000 Touch Thermal Cycler were used for qPCR experiments ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Aliquots of the samples were organized in a 96well PCR plate and reverse transcribed to cDNA using the iScriptTM Reverse Transcription Supermix kit and protocol (BioRad; Hercules, CA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary antibody was washed away 5× with TBS-T and developed with an AP Conjugate Substrate Kit (Bio-Rad). Spots were quantified using a Nikon ELISPOT system and NIS-Elements AR software (v ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the protein concentrations of the supernatants were determined using DC™ Protein Assay Kit (Bio-Rad #5 000 112). Equal concentrations of protein (30 μg ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were immunoprobed using an HRP-conjugated secondary antibody (dilution 1:3000) and chemiluminescent substrate (Clarity Western ECL substrate, Bio-Rad, Hercules, CA, USA). Blot image acquisition was performed using a Molecular Imager® Gel Doc™ XR+ system (Bio-Rad ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein levels were quantified with ImageLab software after acquisition of chemiluminescent signals with a Chemidoc digital imager (Bio-Rad, Marnes-la-Coquette, France). For all SDS-PAGE analyses ...
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots were developed using the SuperSignal West Pico chemiluminescent substrate (Pierce,ThermoScientific) and analyzed using the ChemiDoc XRS + imagingsystem (Bio-Rad, http://www.bio-rad.com/). Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2024Quote: ... The blots were developed using the Luminata Forte Western Chemiluminescent HRP Substrate (MilliporeSigma, Burlington, MA, USA) and visualized on a ChemiDoc Imaging System (Bio-Rad, Hercules, CA, USA). Densitometry analysis was performed using Image Lab software version 6.0 (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein bands of interest were detected using a chemiluminescent reagent (luminol, p-coumaric acid, and hydrogen peroxide) and a ChemiDoc system (Bio-Rad, Hercules, CA, USA). Densitometric analysis was performed using ImageJ software v1.53 (National Institute of Health ...
-
bioRxiv - Biophysics 2019Quote: ... the resulting formazan dye was quantitated with a scanning multi-well plate spectrophotometer (Biorad iMark plate reader). The absorbance directly correlates to the number of viable cells ...
-
bioRxiv - Microbiology 2022Quote: ... and transferred into a 96-well PCR plate (heat-sealed with a foil plate seal, Bio-Rad). PCR was carried out in a C1000 thermal cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... thin walled plates 384-well PCR Plate (ABgene 12164142) by using SYBR Green Supermix (Biorad, 172-5124), 10% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The plates were washed using a 96-well plate magnetic handheld washer from Bio-Rad (NSW, Australia). The Bio-Plex Manager 3.0 software was used to operate the system and interpret the data.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification reactions of each DNA sample were performed in PCR plates (hard-shell PCR plate, #HSP9645; Bio-Rad), in a volume of 25 μl containing 12.5 μl PCR buffer (HotstarTaq mastermix ...
-
bioRxiv - Cell Biology 2022Quote: ... Up to 5 μg of total RNA was reverse transcribed into cDNA using iScriptTM Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad). Quantitative real time-PCR was performed using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysates were sonicated with a microtip for 5 sec at 20% amplitude and quantitated in DC Protein Assay kit II (BioRad, 5000112) against a BSA standard curve ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription (RT) was performed from 2 to 5 µg of RNA with iScript Adv cDNA synthesis kit (Bio-Rad #1725038). The cDNA was diluted 5 times and 1 μL of this was used for each reaction in real-time PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... In this assay chemiluminescent reagent was used and the image of spots was captured using a Flour-S Max Multi-imager (Bio-Rad Laboratories, Hercules, CA, USA), and the spot density was determined with Quantity One Software (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... Bio-Dot SF Microfiltration Apparatus plates (BioRad) were used to transfer the protein samples onto the nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2021Quote: ... in 96 well PCR plates (Bio-Rad) on a CFX96 Touch Real Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... in 96-well reaction plates (Bio-Rad). For pS6- and Sst-TRAP experiments ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were imaged using a ChemiDoc (Biorad).
-
bioRxiv - Immunology 2023Quote: ... plates were placed in a thermocycler (BioRAD), where it is heated to 65 °C for 2min and cooled to 10 °C for 5min ...