Labshake search
Citations for Bio-Rad :
401 - 450 of 4919 citations for 7 8 Dihydro 6H 1 6naphthyridin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Band intensities were visualized by ChemiDoc using the Quantity One software (BioRad, Hercules, CA).
-
bioRxiv - Genomics 2021Quote: ... One cell per well was sorted into 384-well hard-shell plates (Biorad, HSP3801) containing 5 μL of filtered mineral oil (Sigma #69794 ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad, Hercules, CA, USA) and primers listed in Table 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... One part sample was mixed with two parts native sample buffer (Cat#1610738, BioRad) and loaded on the same gradient stain-free gel as above ...
-
bioRxiv - Microbiology 2022Quote: ... The ddPCR was conducted on a One-Step QX200 system (Biorad Hercules, CA, USA) using the Evagreen or Taqman technologies ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The fluorescent intensities of RFP and GFP were quantitated using Quantity One software (Biorad) volume analysis tool ...
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... Densitometric analysis was performed on scanned autoradiographs using the Quantity One software (Bio-RAD).
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022). Copy numbers were calculated with a regression curve from control RNA transcript standards and normalization to per µg RNA in cortex or per ml CSF ...
-
bioRxiv - Genomics 2023Quote: ... One cell per well was sorted into 384-well hard-shell plates (Biorad, HSP3801) containing 5 µL of filtered mineral oil (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... for one hour at room temperature and revealed using ChemiDoc (BioRad, Hercules, CA, USA).
-
bioRxiv - Plant Biology 2023Quote: ... with KOD One PCR Master Mix (TOYOBO) on a Light-Cycler 480 (BIO-RAD) (SI Appendix ...
-
bioRxiv - Pathology 2023Quote: ... The gray intensity was measured by the software of Quantity One (Bio-Rad, CA).
-
bioRxiv - Neuroscience 2023Quote: ... using the iTaq™ Universal Probes One-Step Kit for probes (Bio-Rad Laboratories). The samples were run in 384-well formats in triplicates as multiplexed reactions with a normalizing internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... Optical density of the bands was quantified using Quantity-one software (BIO-RAD, USA). To control for equal protein loading ...
-
bioRxiv - Molecular Biology 2023Quote: ... and different replication-associated DNA molecules were quantified using Quantity One 4.6 software (BioRad).
-
bioRxiv - Molecular Biology 2024Quote: ... and different replication-associated DNA molecules were quantified using Quantity One 4.6 software (BioRad).
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 and 8 using a BioRad TC10 Automated cell counter (BioRad Laboratories, Inc). Growth curves were conducted 5-times ...
-
bioRxiv - Plant Biology 2019Quote: ... The proteins were resolved on 8 or 10% SDS-PAGE (1610156, Bio-Rad) and transferred using the wet transfer method onto a nitrocellulose membrane (10600001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Cell Signaling Akt Panel 8-plex (BioRad, USA; LQ00006JK0K0RR) were used for phosphorylated protein quantification and Bio-Plex Pro Total Akt (BioRad ...
-
bioRxiv - Synthetic Biology 2021Quote: All SDS-PAGE gels contained 8% acrylamide bis-tris (Bio-Rad, pH 6.5). Samples were boiled in 1× Laemmli sample buffer at 90°C for 5 mins before loading to the gels ...
-
bioRxiv - Genomics 2019Quote: ... LIPC_F and LIPC_R (Supplemental Table 8)] by qPCR using SsoFast EvaGreen Supermix (BioRad), according to manufacturer’s protocol.
-
bioRxiv - Biophysics 2020Quote: Polyacrylamide (PAA) substrates were prepared by mixing 8% acrylamide (Bio-Rad, Hercules, CA), 0.1% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... or 0.2 mL white 8-tube PCR strips and optical caps (Bio-Rad). For bacterial cultures ...
-
bioRxiv - Pathology 2023Quote: ... 8 ng of cDNA was used for the SYBR green reagent (BioRad 1725270) reaction for qPCR analysis (BioRad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins were separated using a 8-16% Mini-PROTEAN Precast Protein gels (BioRad) and transferred to Immobilon-P PVDF membrane (Millipore) ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... avara pased the quality checks (i.e., RIN > 8 in Experion, Bio-Rad, USA). In short ...
-
bioRxiv - Cancer Biology 2024Quote: SDS-PAGE Gels (8% or 10%) were transferred to nitrocellulose membranes (Bio-Rad) using a Trans-blot apparatus (2.5 A constant ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μl cDNA (diluted 1:5) using a CFX384 real-time system qRT-PCR machine (BioRad). Primers were designed using Benchling and purchased from Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were then blocked for 1 h at 25 °C with 5% non-fat dry milk (BioRad) in TBST (50 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 1 h at room temperature in 5% skim milk (Catalog #170-6404, Bio-Rad). Primary antibody incubations were performed overnight at 4°C with antibodies diluted in TBS/0.1% Tween-20/5% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were diluted 1:1000 in PBS-T containing 5% blotting-grade blocker (Bio-Rad, #1706404). Membranes were incubated overnight (≈16 h) ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated shaking for 1 hour at RT with 4% blocking solution (5% milk powder (BioRad) in TBS-T) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Synthesized cDNA was diluted 1:10 and 5 µl mixed with SsoAdvanced Universal Sybr Green supermix (Biorad). qPCR was performed using the Biorad CFX96 PCR machine ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µg of each extract was loaded on 7-12% precast SDS-polyacrylamide gels (Bio-Rad). After transference ...
-
bioRxiv - Microbiology 2019Quote: ... For WB proteins were transferred (25 V, 1.3 A, 7 min) onto nitrocellulose membranes (Bio-Rad) using Bio-Rad Trans Blot Turbo Transfer system ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were resolved on 7 cm pH 3-10 immobilized pH-gradient (IPG) strips (Bio-Rad), under mineral oil ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted using a 20:7:3 mixture of buffer: 4x Laemmli sample buffer (Biorad):10x NuPage sample reducing agent (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 7 μL RNase-free water and 10 μL iQ SYBR○R Green Supermix (Bio-Rad, USA). The standard curves were constructed from a series of 10-fold dilutions of a plasmid DNA obtained by TOPO TA cloning (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Standard SDS-PAGE was performed with BioRad 7-12% TGX gels (4561086; BioRad, Hercules, CA, USA) and polyvinylidine difluoride (PVDF ...
-
bioRxiv - Plant Biology 2024Quote: ... consisting of 7 μL Sso Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.28 μL of each primer (10 μM) ...
-
bioRxiv - Immunology 2022Quote: ... diluted to 1:5,000 in 1X TBST 5% milk powder for 1 hour before visualisation with Clarity™ Western ECL Substrate (Bio-Rad, Hercules, California, US) using a Syngene G ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Cell Biology 2020Quote: ... TBST (50 mM Tris-HCl pH 7.4, 1% Triton X-100) with 5% non-fat milk (Bio-Rad) was used for blocking ...