Labshake search
Citations for Bio-Rad :
401 - 450 of 5269 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Transfer buffer was prepared as a 1X final solution by mixing 7:2:1 of ddH2O: methanol: 10X Tris/Glycine Transfer Buffer (Bio-Rad #1610734). Following transfer ...
-
bioRxiv - Biophysics 2023Quote: ... The mixture was incubated for 1-2 h at 4 °C and incubated overnight with pre-washed bio-beads (Bio-Rad Laboratories) at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... lysates were prepared by diluting samples to contain 20-30 μg of total protein in a 2:1 ratio with 4X LaemmLi sample buffer (Bio-Rad, #1610747) enriched with 100 mM Dithiothreitol (DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were then washed three times for 5 min with 1x TBST and incubated with either an anti-mouse IgG- HRP-conjugate (1:5000, Bio-Rad Cat#172-1011) or an anti-rabbit IgG-HRP-conjugate (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and incubated with goat anti-rabbit IgG-alkaline phosphatase-conjugate secondary antibody (Bio-Rad, 1:3000 dilution) for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... Non-specific binding sites were blocked at room temperature for 1 hour with 5% (w/v) Blotting-Grade milk (Bio-Rad Laboratories, CA, USA) in Tris-buffer saline (Boston Bio Products ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... one aliquot of Amberlite XAD-2 (BioRad) was added and allowed to incubate for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... Bio-Beads SM-2 Adsorbents from Biorad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 50 mg of Biobeads SM-2 (BioRad) were added to remove detergent and promote protein insertion into liposomes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... containing 2 g Chelex-100 resin (BioRad) to remove divalent metals ...
-
bioRxiv - Biophysics 2021Quote: ... and 2 μL β-mercaptoethanol (Bio-Rad) were added to 30 μL of sample ...
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad, Cat#161–0142) as described elsewhere 48 ...
-
bioRxiv - Biophysics 2021Quote: ... 200 mg of BioBeads (SM-2, BioRad) were added and the sample incubated for another 3 h at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 10% 2-Mercaptoethanol (Bio-Rad, #1610710) and were heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: Kallestad Hep-2 Complete Kit (Bio-rad) was used to detect ANA reactive fecal IgA following the kit instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Bio-Beads (SM-2 resin; Bio-Rad) were added to the lysis reaction and samples were incubated for 1 hour in a mini-shaker (PS-3D ...
-
bioRxiv - Plant Biology 2020Quote: ... freshly supplemented with 2-mercaptoethanol (Biorad #1610710), heated for 30 min at 37°C and loaded into a polyacrylamide gel (any kD™ precast protein gel ...
-
bioRxiv - Biophysics 2020Quote: ... +/- 2-Mercaptoethanol (βME) (Bio-Rad Cat# 1610710). NuPAGE© gels (4-12% - Thermo Fisher Scientific Cat# NP0321 ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Immunology 2021Quote: ... 100 mg of biobeads SM-2 (BioRad) were added to the resin containing the protein of interest and the peptidiscs and incubated O/N at 4 ° C ...
-
bioRxiv - Biophysics 2024Quote: ... Bio-Beads SM-2 resin (Bio-Rad) was added into the mixture ...
-
bioRxiv - Cell Biology 2023Quote: ... 666 µL 2% bis-Acrylamide (Biorad, 1610142) and 3.08 mL ddH2O ...
-
bioRxiv - Cell Biology 2023Quote: ... 583 µL 2% bis-Acrylamide (Biorad, 1610142) and 3.16 mL ddH2O ...
-
bioRxiv - Cell Biology 2023Quote: ... 604 µL 2% bis-Acrylamide (Biorad, 1610142) and 1.896 mL ddH2O ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.5 mL of 2% Bis-Acrylamide (Biorad) and 1.1 mL of water ...
-
bioRxiv - Physiology 2023Quote: ... 2 µL of protein ladder (BIORAD 1610374) was used ...
-
bioRxiv - Bioengineering 2023Quote: ... Bio-beads SM-2 Resin (Bio-Rad) were introduced to the purified nanocage samples at a ratio of 5 g per 25 mL ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 x Laemmli buffer (Bio-Rad, 1610737), 10 mM DTT (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Biophysics 2024Quote: ... 325 μl of 2% acrylamide (BioRad, 610142), 5 μL of acrylic acid (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... Kallestad HEp-2 cell line slides (BioRad) were incubated with the sera ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.833 ml 2% bis-acrylamide (Bio-Rad), and 1.042 ml water ...
-
bioRxiv - Biophysics 2024Quote: ... then 350 mg BioBeads SM-2 (BioRad) per mL mixture (w:v ...
-
bioRxiv - Biophysics 2024Quote: ... Afterwards Bio-Beads SM-2 (Bio-Rad) was added and was gently mixed for 30 min at room temperature and moved to 4º C ...
-
Pushed to the edge: hundreds of myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2024Quote: ... Bio-Beads SM-2 (BioRad, 152-8920) were washed with methanol 3x ...
-
bioRxiv - Pathology 2024Quote: ... supplemented with 2-Mercaptoethanol (BIO-RAD 1610710) (5 min ...
-
bioRxiv - Biophysics 2024Quote: ... Bio-Beads SM-2 resin (Bio-Rad) was added into the mixture then gently rotated overnight at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... membranes were incubated 2h in TBS-T with 2% BSA containing secondary anti-rabbit antibodies-HRP conjugate (1:2000, #1721019 Bio-Rad, Hercules, CA). After three more washes in TBS-T ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...