Labshake search
Citations for Bio-Rad :
401 - 450 of 8616 citations for 4 Fluoro 5 1 pyrazolyl 2 nitrobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4-12% acrylamide gels (BioRad) were loaded with protein samples ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were then blocked for 1 h at 25 °C with 5% non-fat dry milk (BioRad) in TBST (50 mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 1 h at room temperature in 5% skim milk (Catalog #170-6404, Bio-Rad). Primary antibody incubations were performed overnight at 4°C with antibodies diluted in TBS/0.1% Tween-20/5% BSA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Synthesized cDNA was diluted 1:10 and 5 µl mixed with SsoAdvanced Universal Sybr Green supermix (Biorad). qPCR was performed using the Biorad CFX96 PCR machine ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were diluted 1:1000 in PBS-T containing 5% blotting-grade blocker (Bio-Rad, #1706404). Membranes were incubated overnight (≈16 h) ...
-
bioRxiv - Developmental Biology 2020Quote: ... We ran the qPCR reactions using 1-2 µl cDNA in SYBR Green Master Mix (Biorad) totaling 20 µl in a Biorad CFX96 machine using 60°C as the annealing temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in monomer solution (1 x PBS, 2 M NaCl, 2.5% acrylamide (Bio-Rad), 0.15% Methylenbisacrylamide (Santa Cruz) ...
-
bioRxiv - Genetics 2022Quote: ... 1-2 μg RNA was used for cDNA synthesis using the iScript Advanced kit (Bio-Rad), following the manual.
-
bioRxiv - Microbiology 2022Quote: ... Commercial antibodies were used for β-tubulin (clone YL1/2, Bio-Rad, Watford, UK; 1:5000), β-actin (Abcam ab8227 ...
-
bioRxiv - Neuroscience 2024Quote: ... containing Factor 1 and Factor 2 at manufacturer- recommender concentrations (Bio-Rad, Hercules, CA; cat #171304011). Lung tissues were similarly homogenized in RIPA buffer (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... diluted to 1:5,000 in 1X TBST 5% milk powder for 1 hour before visualisation with Clarity™ Western ECL Substrate (Bio-Rad, Hercules, California, US) using a Syngene G ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 100 V for 1 hr in 4°C pre-chilled 1X Tris-Glycine buffer (Bio-Rad 161-0734). Membranes were blocked for 1 hr at room temperature in blocking buffer (PBS (Gibco 14190-144) ...
-
bioRxiv - Biochemistry 2020Quote: ... The reconstitution sample was nutated for 1 h at 4°C before addition of 0.2 g/mL SM2-BioBeads (BioRad), and the reconstitution sample was further nutated overnight at 4°C before removal of the biobeads ...
-
bioRxiv - Microbiology 2020Quote: ... 7.5 mg of proteins were diluted in ChIP buffer supplemented with 0.01% SDS and precleared 1 h at 4 °C with 50 μl of protein A agarose beads (BioRad) and 100 μg BSA ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots were washed 4 times with TBST and incubated with secondary antibody (1:2000, HRP-conjugated anti rabbit, BioRad) for 1hr at room temperature then washed 4 times with TBST ...
-
bioRxiv - Bioengineering 2021Quote: ... A sample containing 1-20µg of protein was loaded into a 4-15% precast gel (Bio-Rad Mini-ProTEAN) and run at 60V for 20min followed by 160V for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were stained overnight at 4°C with a 1:1000 diluted mouse anti-his primary antibody (MCA1396, RRID:AB_322084, Bio-Rad) and then for 1 hour at room temperature with a 1:4000 diluted rabbit anti-mouse HRP secondary antibody (SouthernBiotech Cat# 6170-05 ...
-
bioRxiv - Biochemistry 2023Quote: ... CCT was immunoprecipitated from the lysate by adding 4 µg of a CCT5 antibody (BioRAD MCA2178, 1:100 IP) and incubating for 30 minutes at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Biophysics 2022Quote: The purified proteins of V2HeR3 were reconstituted into a mixture of POPE and POPG membranes (molar ratio = 3:1) with a protein-to-lipid molar ratio of 1:20 by removing DDM using Bio-Beads (SM-2; Bio-Rad, CA, USA). The reconstituted samples were washed three times with 1 mM NaCl and 2 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... each lysate was diluted at a 1:1 ratio with a solution of 2× Laemmli sample buffer (#1610737EDU, Bio-Rad, Hercules, CA, USA), containing 5% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentrations were determined with the bicinchoninic acid (BCA) protein kit (BioRAD).
-
bioRxiv - Molecular Biology 2022Quote: ... nucleic acid stain were imaged with ChemiDoc XRS+ Gel Imaging System (BIORAD). The 1 Kb Plus DNA Ladder (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... and agarose gel in tris/acetic acid/EDTA (Bio-rad, California, USA) were used for different stiffness ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bones were then decalcified by rocking in 19 % ethylenediaminetetraacetic acid (Biorad, 1610729) for 14 days at 4 °C with solution changes every other day ...
-
bioRxiv - Bioengineering 2024Quote: ... equipped with Aminex Fast Acid Analysis and HPX-87H columns (Bio-Rad) at 55°C and 2 mM H2SO4 as the eluent at a flow rate of 0.5 ml min-1 ...
-
bioRxiv - Cell Biology 2020Quote: ... TBST (50 mM Tris-HCl pH 7.4, 1% Triton X-100) with 5% non-fat milk (Bio-Rad) was used for blocking ...
-
bioRxiv - Genetics 2021Quote: ... Samples were then diluted 1:5 and placed into a 96 well plate with Supermix (no dUTPs, BioRad) and the required target locus primers and MGB-NFQ probes (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesized with 1-5 μg of RNA using iScript cDNA synthesis kit (Bio-Rad). mRNA levels were measured using qRT-PCR with SYBR Green Master Mix (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunohistochemistry was performed on paraffin sections (5 μm) using antibody F4-80 (Bio-rad, France; diluted 1:100). Sections were incubated overnight at 4°C ...
-
bioRxiv - Physiology 2021Quote: ... Membranes were blocked 1 hour in skim milk 5% TBS-Tween buffer (TBST, Bio-Rad, 0.05% Tween 20), and incubated overnight with the primary antibodies diluted in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 h at room temperature with 5% non-fat dry milk (Bio-Rad Laboratories) in Tris-buffered saline (TBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were blocked at room temperature for 1 hour in 5% nonfat dry milk (blocking grade, Bio-Rad) dissolved in Tris-buffered saline containing 0.1% Tween 20 (TBST) ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...