Labshake search
Citations for Bio-Rad :
401 - 450 of 3158 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µl precision melt supermix (Bio-Rad, Germany) and 1 µl DNA was used for real-time PCR ...
-
bioRxiv - Immunology 2024Quote: ... then blocked with 5% blocking protein (Bio-Rad) for 1.5h at 37°C and washed four times again ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of SYBR Green mix (Bio-Rad) and 0.9 μL of RNase-DNase free water (Promega ...
-
bioRxiv - Genetics 2020Quote: ... 1 μL diluted cDNA (5 ng) in a total volume of 5 μL using a CFX384 Real-Time System (Bio-Rad). For each experimental sample (four source colonies ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...