Labshake search
Citations for Bio-Rad :
4151 - 4200 of 10000+ citations for rno mir 137 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Detection and concentration of target-DNA was assessed using droplet-digital-PCR (QX200 Droplet Digital PCR system with AutoDG, Bio-Rad Laboratories, Hercules, USA). A tissue-extracted DNA sample of O ...
-
bioRxiv - Immunology 2022Quote: ... The synthesized cDNA was used to measure mRNA levels by qRT-PCR using the CFX96 PCR Detection System (Bio-Rad Inc., Hercules, CA, USA) described previously (38–40).
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Microbiology 2021Quote: ... the NC membrane was rewashed three times with PBST and imaged with ECL Western blotting detection system (Biorad, Cat# 1705062).
-
bioRxiv - Microbiology 2024Quote: ... Blots were further washed three times before chemiluminescence detection (SQ201, Yamei Biotech) using the ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was subsequently washed 3 times in TBS+0.05 % Tween-20 over 45 min and incubated with secondary antibodies for 1 h at RT (20 °C) after washing 3 times in TBS+0.05 %Tween-20 and developed by enhanced chemiluminescence (Bio-Rad) with Image Quant™ LAS 4000.
-
bioRxiv - Cell Biology 2020Quote: ... and GAPDH (forward CAAGGTCATCCATGACAACTTTG and reverse GTCCACCACCCTGTTGCTGTAG) by RT-PCR using the SYBR Supermix (Bio-Rad Laboratories) on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT-PCR was performed using the PerfeCTa SYBR Green SuperMix (Quantabio, 95071) on CFX96 system (Biorad) following manufacturer instructions ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative RT-PCR were performed using ddPCR (digital droplet) Supermix for Probes (186-3024, BioRad, Hercules, CA) on a Bio-Rad QX200 droplet digital PCR system (BioRad) ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was reverse transcribed using iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad Laboratories, Hercules, CA). Then RT-qPCR was conducted using SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Bioengineering 2020Quote: ... RT-PCR was performed using Biometra T-Personal Thermal Cycler with iScript Reverse Transcription Supermix (Bio-Rad). qPCR was performed using the Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Biophysics 2021Quote: ... QPCR was performed with the Applied Biosystems 7900HT RT-PCR instrument using SYBR Green Supermix (Bio-Rad) with indicated primers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... the RT-PCR reaction was assembled in SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, 1725271) with 0.5μM of each primer ...
-
bioRxiv - Immunology 2022Quote: ... Diluted pre-amplification product was used to complete RT-PCR using iTaq Universal SYBR Green Supermix (BioRad) and 16s M ...
-
bioRxiv - Developmental Biology 2022Quote: ... A BioRad CFX96 RT system was used to perform qRT-PCR using SsoAdvanced Universal SYBR Green (BioRad). n=3 technical replicates (i.e. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad, Mississauga, ON) using the primers listed in Supplementary Table S1A ...
-
bioRxiv - Molecular Biology 2019Quote: ... using a 96-well Bio-Rad CFX96 RT-PCR System with a C1000 Thermal Cycler (Bio-Rad). A Cq value was obtained from each amplification curve using CFX96 Analysis Software provided by the manufacturer ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCRs were carried out using a Bio-Rad iCycler (CFX96, Bio-Rad, Santa Rosa, California, USA) with the following cycling conditions ...
-
bioRxiv - Genomics 2021Quote: ... RT-PCR amplicons were electrophoresed on 2 % agarose gels and imaged on a ChemiDoc MP (Bio-Rad). The resulting images were analyzed using ImageJ (v1.52a) ...
-
bioRxiv - Plant Biology 2021Quote: ... and quantitative reverse transcription PCR (RT-qPCR) was performed using the CFX96™ Thermal Cycler (Bio-Rad) and GoTaq® Master Mix (Promega) ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative RT-PCR was performed using SsoFast™ EvaGreen® Supermix with Low ROX (Bio-Rad, 1725212) on a CFX96™ Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... SYBR Green quantitative (q)RT-PCR was performed using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) on a StepOnePlus system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: Quantitative RT-PCR was performed using gene specific primers and iTaq Universal SYBR Green Supermix (Bio-Rad). A standard curve was generated for each experiment by pooling cDNA from all samples and serially diluting to generate concentrations of 25 ng/μl ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each sample underwent RT-PCR in triplicate using Reliance One-Step Multiplex Supermix (Bio-Rad Laboratories, 12010220) and specific probe sets for each gene ...
-
bioRxiv - Neuroscience 2024Quote: ... Changes in Grin2d gene expression were determined via RT-PCR using SsoAdvanced Universal SYBR Green Supermix (BioRad) and PrimeTime qPCR Primers (IDT ...
-
bioRxiv - Neuroscience 2024Quote: ... Changes in Grin2d gene expression were determined via RT-PCR using SsoAdvanced Universal SYBR Green Supermix (BioRad) and PrimeTime qPCR Primers (IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The iScript RT Supermix for RT-qPCR (BioRad, 1708841) was used for cDNA synthesis ...
-
bioRxiv - Bioengineering 2021Quote: ... was used to prepare the qPCR reaction that was run on a CFX384 Real Time Thermal Cycler (BioRad, Hercules, CA). Additional AAV was tested for eGFP transgene expression using an in vitro assay ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real-time polymerase chain reaction (qPCR) was performed using iTaq Universal SYBR Green qPCR Master Mix (Biorad, Hercules, CA), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantification of relative gene expression was performed using the comparative CT method (2-ΔΔCt) (Schmittgen & Livak, 2008) on a CFX96 Real-Time System (BioRad). Primers used are listed in Supplemental Table 1.
-
bioRxiv - Plant Biology 2021Quote: ... The libraries were diluted to 10nM and further quantitated by qPCR on a CFX Connect Real-Time qPCR system (BioRad) for accurate pooling of the barcoded libraries and maximization of number of clusters in the flow cell ...
-
bioRxiv - Microbiology 2019Quote: ... The qPCR was performed on a CFX96 Real-Time System on top of a C1000 Touch Thermal Cycler (Bio-Rad), and analyzed using the CFX Manager 3.0 software (Bio-Rad) ...
-
bioRxiv - Bioengineering 2019Quote: ... and the selected primers (Table S1, Supplementary Information) to perform qPCR using CFX Connect™ Real-Time System (Bio-Rad) under the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was diluted in nuclease-free water and quantified using SsoAdvanced Universal SYBR Green Supermix on a CFX Connect Real-Time System (BioRad) with the following amplification scheme ...
-
bioRxiv - Microbiology 2020Quote: ... The relative expression of each miRNA was expressed as by the CFX Connect Real-Time System (Bio-Rad, Hercules, CA).
-
bioRxiv - Microbiology 2021Quote: ... SsoAdvanced™ Sybr Green Supermix was used on a CFX96 Real-Time System (C1000 Thermal Cycler, Bio-Rad Laboratories, CA) with the primers specified in table 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... The thermal melt was carried out in CFX384™ Real Time System attached to a C1000 Touch Thermal Cycler (Biorad). The program was set to go from 25°C to 90°C with a step of 1°C and incubation time of 2 min/°C ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR was carried out in triplicates and was performed at a 2-step reaction with 95°C denaturation and 56°C annealing and extension for 35 cycles on a CFX96 Real-Time System (BIORAD). Relative quantification of target genes was determined using Bio-Rad CFX manager 3.1 software ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-PCR was performed on a CFX96 Real-Time System with a Biorad C1000 Touch Thermal Cycler using Sso Advanced SYBR Green (Biorad). Thermocycler conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... in accordance with the manufacturer’s instructions and then placed in a thermocycler (BIO-RAD CFX96™ Real-Time System, USA). Specific RT-qPCR for BAV and JEV was performed using the reported primers and probes (STable 1)[7][14][15] ...
-
bioRxiv - Immunology 2021Quote: ... The amount of HIF1α-bound regions of the ImpL2 promoter was quantified on a 96CFX 1000 Touch Real-Time Cycler (BioRad) using TP 2x SYBR Master Mix (Top-Bio ...
-
bioRxiv - Microbiology 2021Quote: ... Amplification was with BioRad iTaq Universal SYBR green supermix in a CFX96 real-time C1000 thermal cycler (BioRad, Hercules, CA) and each qPCR reaction was performed at the following thermal profile ...
-
bioRxiv - Cell Biology 2022Quote: ... and assays (Table S3) were used for real-time qPCR (Thermo Fisher, Applied Biosystems QuantStudio 3 and BioRad CFX 384) to determine CXCL12 ...
-
bioRxiv - Pathology 2022Quote: ... with an in-house full virus standard for determination of genome loads on a C1000 thermal cycler with the CFX96 Real-Time System (Biorad).
-
bioRxiv - Plant Biology 2023Quote: ... Transcript expression was quantified by real-time qPCR using iQ SYBR Green super mix (Bio-Rad Laboratories, Hercules, CA, USA), as previously described (Fichman et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and P-TEFb OE and wild-type (w1118) chromatin (CycT) were analyzed by qPCR on a CFX96 Real-Time System (BioRad). qPCR reactions were carried out using 2 μl of ChIP DNA as a template with 300 nM primers and 5X HOT FIREPol® EvaGreen® qPCR Mix Plus (Solis BioDyne ...
-
bioRxiv - Immunology 2022Quote: Libraries were diluted to 10nM and further quantitated by qPCR on a CFX Connect Real-Time qPCR system (Biorad, CA) for accurate pooling of barcoded libraries and maximization of number of clusters in the flowcell ...
-
bioRxiv - Microbiology 2024Quote: ... 0.2 μM of each primer and 2 μl of template cDNA on a CFX Connect Real-Time System (Bio-Rad). Samples and plasmid standards were amplified using the following protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The libraries were diluted to 10nM and further quantitated by qPCR on a CFX Connect Real-Time qPCR system (Biorad) for accurate pooling of barcoded libraries and maximization of number of clusters in the flowcell ...
-
bioRxiv - Genetics 2023Quote: The expression levels of non-ribosomal peptide synthetase genes were assessed using a real-time amplifier CFX96 (Bio-Rad, USA) and a commercial “PCR-mix SYBR Green I kit” (Syntol ...