Labshake search
Citations for Bio-Rad :
351 - 400 of 6122 citations for Mouse Probable fructose 2 6 bisphosphatase TIGAR TIGAR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... mouse cytokine 23-plex (Bio-Rad, M60009RDPD), and mouse chemokine 31-plex (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... or goat anti-mouse (170-6516, BIORAD), HRP-conjugated antibodies were applied at a 1:3000 dilution as secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... mouse cytokine 23-plex (Bio-Rad, M60009RDPD), and mouse CXCL10 (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... APC anti-mouse F4/80 (MCA497APC, Biorad), PE anti-mouse CD11b (RM2804 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-mouse IgG (Bio-Rad 1721011) secondary antibodies were used at 1:10000 dilution ...
-
bioRxiv - Bioengineering 2022Quote: ... and anti-mouse DyLight 800 (Bio-Rad), both at a dilution of 1:10,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... A Bio-Plex mouse cytokine assay (BioRad) for simultaneous quantification of the concentrations of several signaling molecules (Il-6 ...
-
bioRxiv - Cell Biology 2019Quote: ... rat anti-mouse CD68 (MCA1957B, Bio-Rad), goat anti-human TSP4 (AF2390 ...
-
bioRxiv - Microbiology 2021Quote: ... goat anti-mouse IgG (Bio-Rad #1706516), and rabbit anti-goat IgG (Bio-Rad #1721034 ...
-
bioRxiv - Cancer Biology 2020Quote: ... rat anti-mouse CD68 (MCA1957B, Bio-Rad), goat anti-human TSP-4 (AF2390 ...
-
bioRxiv - Immunology 2021Quote: ... or anti mouse IgG2c (Bio-Rad Laboratories) at 2 μg/ml in PBST and were incubated for another hour ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP-conjugated goat anti-mouse (Bio-Rad, 170-6516 ...
-
bioRxiv - Cell Biology 2019Quote: ... HRP conjugated anti-mouse IgG (Biorad, 1706516) and HRP conjugated anti-rabbit IgG (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Genetics 2020Quote: ... and Goat Anti-Mouse IgG (Bio-Rad) were used as secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-V5 (1:200, BioRad MCA1360), guinea pig anti-Bsh (1:400 ...
-
bioRxiv - Plant Biology 2022Quote: ... HRP-conjugated anti-mouse serum (Bio-Rad) was diluted at 1:5,000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-mouse IgG-HRP (BioRad, 1:3000). The chemiluminescent signals were obtained by using Chemi-Lumi One (Nacalai) ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse IgG1-HRP (STAR132P, Bio-Rad), anti-mouse IgG2a-HRP (STAR133P ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse CD68(1:200, BioRad, #MCA1957), anti-human CD68 (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: - Mouse anti-V5 tag (Bio-Rad, MCA1360) used at dilution 1:5000 for Western Blot
-
bioRxiv - Immunology 2023Quote: ... anti-mouse IgG2a-HRP (STAR133P, Bio-Rad), anti-mouse IgM-HRP (II/41 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and goat-anti-mouse (Bio-Rad #1706516). Protein bands were visualized using chemiluminescence substrate (PerkinElmer #NEL104001EA ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-mouse IgG (Bio-Rad, AUS) or or IgA (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Fluorescent secondaries anti-mouse Starbright 700 (Biorad) and anti-rabbit Starbright 520 (Biorad ...
-
bioRxiv - Genomics 2023Quote: - Mouse anti-V5 tag (Bio-Rad, MCA1360) used at dilution 1:5000 for Western Blot
-
bioRxiv - Cancer Biology 2024Quote: ... rat anti-mouse CD68 (1:500 BioRad), goat anti-rabbit 488 (1:500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... dimethyl sulfoxide (DMSO) was added and the absorbance of each well was measured at 490 nm using an ELISA microplate reader (Bio-Rad, Hercules, CA, USA) (33).
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...