Labshake search
Citations for Bio-Rad :
351 - 400 of 9557 citations for Borrelia burgdorferi C p Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Protein was quantified using the DC Protein Assay (BioRad, 5000112). Western blots using 10μg of protein were performed as described below.
-
bioRxiv - Developmental Biology 2021Quote: ... 4 mg of protein (quantified by Bradford protein assay, Biorad) was collected ...
-
bioRxiv - Genetics 2021Quote: Protein concentrations were determined using the DC Protein Assay (BioRad) using a Bovine Serum Albumin standard curve ...
-
bioRxiv - Immunology 2020Quote: ... Protein concentration was quantified using a quickstart protein assay (BioRad). Proteins were resolved by SDS-PAGE on 10% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: Protein extracts were quantified by DC Protein assay (Bio-Rad), and equal amounts of proteins were separated by SDS-polyacrylamide gel electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein levels were quantified using DC Protein Assay (Bio-Rad), protein extracts were subject to SDS-PAGE gel electrophoresis and transferred to nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Genetics 2022Quote: ... Protein concentration was determined via the DC protein assay (BioRad) as per manufacturer’s instructions ...
-
Co-stimulatory molecules decide T cell fate through regulations of their invigoration and impairmentbioRxiv - Molecular Biology 2022Quote: ... Protein concentration was determined with Bradford Protein Assays (Bio-Rad) and boiled in SDS sample buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein concentration was determined with DC protein assay (Bio-Rad), using bovine serum albumin (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... protein concentrations were determined using the DC Protein Assay (BioRad) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... The protein concentration was determined using Bradford protein assay (Biorad) and were run on a 3-8 % NuPAGE gel as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... Total protein concentrations were determined by DC Protein assay (BioRad). Protein disulfide bonds were reduced by 5 mM of Tris(2-carboxyethyl ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was measured using the DC protein assay (BioRad). Immunoblotting displayed in Figure 1C,D was essentially as described (Kusch et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and protein concentration was assessed using Protein Assay reagent (BIORAD) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... protein concentration was measured using protein assay dye (Bio-Rad). For western blot analyses ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein concentrations were determined by Bradford Protein Assay (Bio-Rad) and normalised for equal protein amounts ...
-
bioRxiv - Developmental Biology 2023Quote: ... Protein concentration was determined with a DC Protein Assay (BioRad).
-
bioRxiv - Neuroscience 2023Quote: Protein concentration was determined using the Bradford protein assay (BioRad), according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was determined by DC Protein Assay (Bio-Rad) and equivalent masses of protein were resolved using SDS-PAGE and transferred to 0.2 μm PVDF membranes (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentrations were determined with the Biorad Protein Assay (Biorad). Proteins were separated on precast Novex 10% Tris-Glycine gel / NuPAGE 4-12% Bis-Tris gel at 100V using the Mini Gel Tank (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein was quantified using the DC Protein Assay kit (BioRad) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was quantified using DC protein assay (Bio-Rad) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein was quantified using the DC protein assay (Bio-Rad). Lysates were prepared with 6X SDS sample buffer containing 12% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... Protein concentration was determined using DC Protein Concentration Assay (BioRad). Protein levels of cytokines were determined using Milliplex MAP Kit Mouse Th17 Magnetic Bead Panel (Cat # MTH17MAG-47K ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentration was determined by DC protein assay kit (Biorad). Protein samples were prepared in 1x Laemmli loading buffer (Biorad ...
-
bioRxiv - Immunology 2023Quote: ... Protein amounts were quantified by the DC Protein Assay (BioRad) or by tryptophan fluorescence measurements 41 ...
-
bioRxiv - Neuroscience 2023Quote: ... Precision Plus Protein Dual Color Standard prestained protein marker (Biorad) was used to estimate the molecular weight of sample proteins.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Protein concentration was determined by the DC protein assay (BioRad).
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was measured using DC protein assay kit (BioRad). The sample concentrations were normalized prior to the submission for the analysis by Eve Technologies DM-44 mouse Discovery Assay panel.
-
bioRxiv - Cancer Biology 2023Quote: Protein concentrations were quantified using DC Protein Assay (Bio-Rad). Equal amounts of proteins (30-60µg ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein was quantified by RC DC protein assay (BIO-RAD) based on the modified Lowry protein assay method (Raghupathi & Diwan ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein concentration was determined using DC protein assay (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... Protein concentration was measured using the DC protein assay (BioRAD). To determine the relative binding capacity of the PBD of RNF146(100-182) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein concentration was determined using a DC protein assay (Biorad).
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by DC protein assay (BioRad). For SDS-PAGE ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein concentrations were quantified using DC Protein Assay (Bio-Rad) and compared to an Albumin Standard (Thermo Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... Protein concentration was measured with DC protein assay (Bio-Rad) and equalized using dilution buffer (50 mM TRIS-HCl pH 7.4 ...
-
bioRxiv - Biophysics 2024Quote: ... Protein concentrations were measured with DC protein assay (Bio-Rad), equalized using dilution buffer (50 mM TRIS-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Biochemistry 2020Quote: ... The complex was exchanged into EM buffer using a Bio-Spin P-30 column (Bio-Rad). The concentration of complex was estimated from absorbance at 280 nm and 1 equivalent of dsDNA (61 base pairs ...
-
bioRxiv - Microbiology 2020Quote: ... in a 100 μL reaction for 2 hours and purified using P-30 spin columns (BioRad). The radiolabeled probe was heated to 100°C for 2 minutes and resuspended in 10 mL of ULTRAhyb Oligo hybridization buffer (Ambion) ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Microbiology 2019Quote: ... a hand-packed Bio-Gel P-10 size exclusion column (1.5 × 50 cm, 1504144, Bio-Rad) was used ...
-
bioRxiv - Microbiology 2019Quote: ... a hand-packed Bio-Gel P-4 size exclusion column (1.0 × 50 cm, 1504128, Bio-Rad) was used for glycan separation ...
-
bioRxiv - Immunology 2020Quote: ... the reaction mixture was passed through 2 Bio-Gel P-2 mini columns (1504114, Bio-rad) by centrifugation (3000 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... The final reaction mix was desalted using Micro Bio-Spin P-30 columns (Bio-Rad, 7326250), then denatured by incubating with 0.5X volume of gel-loading buffer (8 M urea ...
-
bioRxiv - Cell Biology 2023Quote: ... P-ATG16L1-S278 antibody was diluted at 1:4000 in EveryBlot blocking buffer (Bio-Rad, 12010020) and incubated overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein (Bio-Rad) was determined on 25µl of the extract.
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration was determined by BioRad Protein Assay (BioRad) and 20 ug protein was resolved by SDS-PAGE in 10% acrylamide gels ...