Labshake search
Citations for Bio-Rad :
351 - 400 of 9090 citations for 7H Azeto 2 1 b 1 3 dioxino 4 5 e 1 3 oxazin 7 one hexahydro 2 6 dimethyl 2S 4aR 5aS 6S 9aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... diluted 1:1,000 in 6% milk in PBS-T followed by α-mouse IgG HRP (Bio-Rad) diluted 1:5,000 in 6% milk in PBS-T ...
-
bioRxiv - Cancer Biology 2023Quote: 6-well culture plates were coated with 1 ml of 0.6 % Low Melt Agarose (Bio-Rad; 1613111). Cells were diluted at a density of 1.0 x 104 cells/ml in media containing 0.3% Low Melt Agarose and seeded 1 ml/ well ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Pathology 2022Quote: ... The expression levels of target proteins were quantified with Quantity One 1-D Analysis Software (Bio-Rad, Hercules, CA) and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Plant Biology 2024Quote: ... The gels were visualised using a UV trans-illuminator Gel Doc 2000 and Quantity One 1-D analysis v4.6.5 software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were resolved on native acrylamide gels containing 0.5X TBE buffer and 7% acrylamide (made from a stock of 40% acrylamide with a ratio of 29:1 acrylamide:bisacrylamide; Bio-Rad). The running buffer for the gels was 1XTBE ...
-
bioRxiv - Bioengineering 2019Quote: Native PAGE gels were prepared as follows: a fresh solution comprising of polyacrylamide (19:1) at final concentrations from 7 to 13% (Biorad), 0.5x TBE buffer (45 mM Tris-borate ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated in vitro by PLK-1 or CyclinB-Cdk1 as described (7) were separated on stain Free SDS-PAGE 10% gel (Biorad). The gel was imaged and then transferred to a PVDF membrane 0.45 µm during 1h30 at 90V ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Immunology 2022Quote: ... diluted to 1:5,000 in 1X TBST 5% milk powder for 1 hour before visualisation with Clarity™ Western ECL Substrate (Bio-Rad, Hercules, California, US) using a Syngene G ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nonspecific binding was blocked for 1 hr at RT with 5% BLOTTO (Bio-Rad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Neuroscience 2020Quote: ... After 1 hour blocking in 5% non-fat milk solution (Bio-Rad 170-6404) at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked for 1 hr using 5% non-fat dry milk (Bio-Rad) and incubated with primary antibody overnight at 4 °C ...
-
bioRxiv - Bioengineering 2019Quote: ... Membranes were blocked for 1 h with 5% fat free milk powder (Bio-Rad) in TBS + 0.05% tween-20 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nonspecific binding was blocked for 1 h at room temperature with 5% blotto (Biorad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates were boiled for 5 min in 1 x Laemmli Sample Buffer (Bio-Rad) containing 5% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:5 and SsoFast EvaGreen Supermix was used (BioRad, California, USA). BipA was used as a housekeeping gene.102 Each repeat was performed in a single qPCR plate ...
-
bioRxiv - Biophysics 2023Quote: ... detergent was removed after 4 h of incubation with Bio-Beads SM-2 (Bio-Rad, USA) pre-equilibrated with the reconstitution buffer ...
-
bioRxiv - Immunology 2023Quote: ... with 10 % 2-Mercaptoethanol and loaded onto 4-20% precast polyacrylamide gels (4561096, 5671095; Bio-Rad). Imaging was performed with enhanced chemiluminescent detection (34096 ...
-
bioRxiv - Genetics 2024Quote: ... 4 mg/ml lyticase) and blended with 300 μl of 2% low-melt agarose (Bio-Rad). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... and F4/80 (Cl:A3-1, Bio-Rad, 1:1000) staining were performed by the Duke Pathology core (Durham ...
-
bioRxiv - Systems Biology 2023Quote: ... F4/80 (Bio-Rad, clone: Cl:A3-1, 1:80), TIM4 (BioLegend ...
-
bioRxiv - Microbiology 2024Quote: ... anti-WC-1 (Bio-Rad, MCA838GA, dilution 1:20) and anti-Pax5 (Agilent DAKO ...
-
bioRxiv - Microbiology 2023Quote: ... The reaction mixtures contained 100 ng RNA template per sample diluted 2-fold with qPCR solution (iTaq Universal SYBR Green One-Step Kit, Bio-Rad) containing the primers D2S and D2C ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was 1:4 diluted in water and mixed with SYBR® Green (Bio-Rad) and the appropriate primers at 5µM ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Plant Biology 2023Quote: ... for 1 h at 4 °C and incubated with protein-G magnetic beads (Bio-rad) for 0.5 h at 4 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... RLUC was detected with a primary anti-RLUC (MBL Life Sciences PM047) 1:2000 in TBST 5% BSA and a secondary anti-Rabbit IgG-HRP (Bio-Rad 170-6515; 1:10000) antibody in TBST 5% milk ...
-
bioRxiv - Immunology 2019Quote: ... Rosa26LSL-tdTomato/+ animals (6-12 weeks) were given 1 μg of FITC-conjugated rat anti-CD169 antibody (BioRad) diluted in a total volume of 20 μl of PBS into the right footpad to label CD169+ subscapular macrophages inside the draining LN ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 mM EDTA in 99.9% deuterium oxide using a spin desalting column (Micro Bio-Spin 6, BioRad). 15N-HSQC spectra were measured every 40 min for 106 hours at 25 °C on Bruker 600 MHz NMR spectrometer ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...