Labshake search
Citations for Bio-Rad :
351 - 400 of 7253 citations for 7 Benzylamino 4 nitrobenz 2 oxa 1 3 diazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Membranes were stained with primary antibody in blocking buffer at 4°C overnight: anti-NP (1:5000, OBT1555, Bio-Rad), anti-PA ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 1:4 and 4.3 µL of cDNA was mixed with 5 µL iTaq Universal SYBR Green Supermix (BioRad 1725124) and 0.7 µL of 5 µM forward and reverse qPCR primers targeting the gene of interest (333 nM final primer concentration ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were spun down at maximum speed for 1 minute and run on precast 4-20% gradient acrylamide gels (BioRad) in 1X Tris-Glycine buffer containing 0.1% SDS ...
-
bioRxiv - Microbiology 2024Quote: ... 7.5 mg of proteins was diluted in ChIP buffer supplemented with 0.01% SDS and precleared for 1 hr at 4°C with 50 μl of SureBeads Protein A Magnetic Beads (BioRad) and 100 μg bovine serum albumin (BSA) ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were prepared for gel electrophoresis by adding a volume containing 20 ug protein to 3 uL 1 M DTT and 7.5 μL 4X Laemmli sample buffer (BioRad Cat. No. 1610747) and topping up to 30 μL with deionized water ...
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was run on an ABI ViiA 7 instrument and analyzed with CFX manager software (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... and transferred onto nitrocellulose at 25 V for 7 min using the Trans-blot Turbo system (Bio-Rad). Blotting efficiency was visualized by red Ponceau staining on membranes ...
-
bioRxiv - Biochemistry 2023Quote: ... and transferred at 1.3 A/25 V for 7 min using the Trans-Blot Turbo system (Bio-Rad). Afterwards ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Cancer Biology 2021Quote: 2 ⨯ 106 CAR T cells collected after 24-day expansion were resuspended with 1 ⨯ Laemmli sample buffer (BIORAD) containing 2.5% β-mercaptoethanol before sonication with 50% amplitude in Sonic Dismembrator (FisherBrand) ...
-
bioRxiv - Biochemistry 2020Quote: ... Both PK-treated and untreated samples were then mixed 1:2 with 4X Laemmli sample buffer (Bio-Rad) containing DTT ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-α-tubulin YL1/2 from rat (MCA77G, Bio-Rad AbD Serotec, at 1:2000 dilution for IF), anti-rabbit Alexa Fluor 488 (A11008 ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized from total RNA (1-2 μg) with iScript Advanced cDNA Synthesis Kit (Bio-Rad; 1725038). Quantitative RT-PCR (qPCR ...
-
bioRxiv - Genetics 2023Quote: ... 1 ml 2xYNB with 2% glucose was added to the sorted cells in sheath fluid (PBS, BioRad #12012932) and they were transferred to a shaking incubator and grown at 30 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bis (2%, Bio-Rad), the sonicated nanorod-water solution (sonicated in in bath sonicator for one hour ...
-
CXCR4-binding PET tracers link monocyte recruitment and endothelial injury in murine atherosclerosisbioRxiv - Pathology 2020Quote: ... MOMA-2 (Bio-Rad), CD45.2 (104 ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (BioRad) were presoaked in methanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2- Mercaptoethanol (BioRad) and ran through a 4-20% Mini-ProTEAN TGX gel (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... with 2-mercaptaethanol (BioRad) and boiled at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Tetrad 2 (BioRad) following the manufactures protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-Mercaptoethanol (BioRad) at 95°C for 5 minutes.
-
bioRxiv - Microbiology 2019Quote: ... Alternatively broken cyst walls either before or after digestion with trypsin were reconstituted in 1× reducing SDS/PAGE loading buffer and run on a 4–20% precast polyacrylamide TGX gel (Bio-Rad). Bands stained by colloidal Coomassie blue were excised and washed with 50 mM NH4HCO3/acetonitrile (ACN) ...
-
bioRxiv - Neuroscience 2021Quote: ... of each sample was loaded on an 8-16% (for TSPO, 3b-HSD, and StAR) or 4-20% (for mERα, caveolin-1, and PKA) SDS precast gels (Bio-Rad) and separated by electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were incubated with primary antibodies (Supplementary Table 1) overnight at 4°C and visualised with HRP-conjugated anti-IgG secondary antibodies and enhanced chemiluminescence substrates (Bio-Rad). The expression of PDHX or calnexin was used as a loading control.
-
bioRxiv - Microbiology 2020Quote: ... Clarified lysates were incubated with 2 ml of glutathione resin and rotated for 1 h at 4°C in a 25 ml disposable drip column (Bio-Rad). Settled resin was washed with 25 column volumes (CV ...
-
bioRxiv - Bioengineering 2020Quote: Organoids fixed in 4% w/v PFA and immunostained were embedded in 1% w/v low melting agarose (Bio-Rad Laboratories) solution and placed in an Eppendorf tube ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were incubated with primary and HRP-secondary antibodies in TBST buffer with 5% milk (RT for 1 hour or overnight at 4 °C) and revealed with an ECL solution (BIO-Rad) following manufacturer’s instructions.
-
bioRxiv - Biophysics 2020Quote: ... supplemented with DTT (0.1 M endconcentration) and then subjected to SDS-PAGE on 12% or 4–20% gradient gels (mini-PROTEAN TGX; Bio-Rad). Proteins were transferred to PVDF membranes (TransBlot® TurboTM LF PVDF ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was incubated for 1 h at 4°C with 0.5 mL Profinity IMAC resin (Bio-Rad Laboratories, Hercules, CA) in a buffer containing 20 mM MOPS-Na (pH 7.4) ...
-
bioRxiv - Biochemistry 2021Quote: ... and increasing concentrations of NONO(53-312) were prepared and incubated at 4°C for 1 hour before loaded onto a Dot Blot apparatus (Bio-rad) containing a nitrocellulose membrane (top ...
-
bioRxiv - Microbiology 2020Quote: The supernatants from the different lysis buffer extractions described above were diluted 1:4 in 4x Laemmli sample buffer (Bio-Rad) supplemented with beta-mercaptoethanol following manufacture’s instructions ...