Labshake search
Citations for Bio-Rad :
351 - 400 of 4216 citations for 7α 12α Dihydroxycholest 4 en 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4% CHAPS and deStreak (BIORAD, Australia). Two equilibration steps were carried out in SDS equilibration buffer consisting of SDS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Lastly 4 μl TEMED (Bio-Rad) and 6 μl freshly prepared Ammonium persulfate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: ... or 4-20% precast gels (BioRad). Gels were transferred onto Immobilon-P PVDF membrane (EMD Millipore) ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free and bound RNA bands were quantified using Quantity One software (Bio-Rad, Hercules, CA) and fit with the Hill equation in Prism.
-
bioRxiv - Biophysics 2019Quote: ... and quantitated by densitometry using a DNA standard curve and Quantity One® software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of the images was performed using Quantity one and Gel doc XR from Biorad (Hercules).
-
bioRxiv - Neuroscience 2021Quote: ... Immunoblots were quantified by densitometric analysis of the fluorograms (Quantity One software; Bio-Rad, Hercules, CA) obtained in the linear range of the emulsion response.
-
bioRxiv - Microbiology 2021Quote: ... Multiplex RT-qPCR assay were carried out using Reliance One-Step Multiplex RT-qPCR Supermix (BioRad) or LightCycler Multiplex RNA Virus Master (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were quantified by densitometry analysis using the Bio-Rad Quantity One software (Bio-Rad). Fragments were pooled in an equimolar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colony counting was performed using a Gel Doc Documentation System and Quantity One software (Bio-Rad) and quantification using Excel software.
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Densitometric analysis was performed using Bio-Rad Quantity One software version 4.3.0 (Bio-Rad Laboratories, Inc.).
-
bioRxiv - Neuroscience 2020Quote: ... and protein immunoreactive bands quantified (Quantity One densitometry software or Image Lab software from Bio-Rad). WB data is presented as fold-increases of a control condition (stated in figure caption) ...
-
bioRxiv - Bioengineering 2019Quote: One hundred microliters of polyacrylamide resin containing different ratios of 40% acrylamide (Bio-Rad 161-0140) and 2%bis-acrylamide (Bio-Rad 161-0142 ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of RNA was converted to cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad). Primers for A1/A2 transcripts were ordered directly from Liddelow et al28 ...
-
bioRxiv - Microbiology 2021Quote: ... quantitative RT-PCR was performed using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad) and the CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RT-qPCR was performed using iTaq Universal One-Step RT-qPCR Kits (Bio-Rad, cat.# 1725150). RT-qPCR primers were designed using Primer359 and are listed in Supplementary Table 13 ...
-
bioRxiv - Immunology 2021Quote: ... Products were analyzed by agarose gel electrophoresis in a ChemiDoc XRS-Quantity One Image Analyzer (BioRad)
-
bioRxiv - Cancer Biology 2022Quote: The protein expression was assayed and densitometric analysis was performed using quantity one software (Bio-Rad) as reported previously (11) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... one microgram of isolated RNA was reverse transcribed using the iScript™ cDNA Synthesis Kit (BioRad). Using the DyNAmo HS SYBR green qPCR kit (F-410L ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fraction bound was determined by densitometry of raw data using Quantity One® (v4.6.7, Bio-Rad) and the following equation for specific bands and then normalized ...
-
bioRxiv - Neuroscience 2022Quote: ... A GS-800 calibrated densitometer with Quantity One 1-D Analysis Software 4.6 (Bio-Rad Laboratories) was used for quantitative analysis of protein levels ...
-
bioRxiv - Zoology 2022Quote: gRNA was quantified by RT-qPCR using the iTaq Universal probe one-step kit (Bio-Rad) with primers and probe targeting the DENV2 envelope [27] ...
-
bioRxiv - Plant Biology 2023Quote: ... One µg of RNA was reverse-transcribed using the iScript™ cDNA Synthesis Kit (Bio-Rad). Real-time quantitative PCR was performed in a final volume of 5 µl including 10% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using the iTaqUniversal SybrGreen one-step kit (BioRad, Hercules, Ca, USA) according to the manual protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Densitometry analysis was performed using Bio-Rad Quantity One image analysis software (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time PCR was performed on CFX97 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... one-step RT-ddPCR (1-Step RT-ddPCR Advanced Kit for Probes, Bio-Rad, Hercules, CA) was used to determine absolute quantification of N and S vRNA copy numbers in culture supernatants and cell lysates using the OC43 ...
-
bioRxiv - Physiology 2024Quote: ... One μg of total RNA was reverse-transcribed as per the manufacturer’s instructions (VWR and BioRad). The SYBRgreen intercalant was used for amplification detection with the Fast SYBRgreen master mix (Applied Biosystems and BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... iTaq Universal SYBR Green One step RT-PCR kit (cat# 1725150) was purchased from Bio-Rad. Mature miR-146a (cat# YP00204688) ...
-
bioRxiv - Neuroscience 2024Quote: ... was used for signal detection and densitometric analyses were performed using the Quantity One software (Biorad).
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR reactions were performed using the iTaq Universal Sybr green One-step kit (Bio-Rad) with the following reaction mix per sample ...
-
bioRxiv - Microbiology 2024Quote: ... with visualization on a Personal Molecular Imager FX scanner and analysis with Quantity One software (BioRad).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...