Labshake search
Citations for Bio-Rad :
351 - 400 of 1598 citations for 6 hydroxy 2 naphthalenesulfonic acid sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Microbiology 2020Quote: Extracellular concentrations of organic acids (acetate, lactate, formate) and ethanol (from 2.4.3) were determined by HPLC (BioRad HPX-87H 300*7.8 mm column ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentration was estimated on the lysates using a bicinchoninic acid protein assay Kit (5000111, Bio-Rad). Equal protein concentrations for each of the samples were incubated with Myc antibodies overnight ...
-
bioRxiv - Microbiology 2023Quote: ... destained in 7.5% acetic acid for 1 minute and imaged using a ChemiDoc imaging system (Bio-Rad). For western blotting ...
-
bioRxiv - Developmental Biology 2021Quote: ... were separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto 0.2 μm nitrocellulose membranes (Bio-Rad Laboratories, US) using a semi- dry technique (Semi-dry Blotter ...
-
bioRxiv - Neuroscience 2019Quote: Purified CXCL12 and CXCL12 Ch/DS NC were resolved by 15% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (Bio-Rad, Hercules, USA) and electro transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Physiology 2019Quote: ... Diluted proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on a 4-20% gradient Criterion TGX Precast Midi Protein gel (Bio-Rad, CA), and subsequently transferred onto nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Bioengineering 2021Quote: ... Proteins were separated and visualized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie Brilliant Blue R-250 (Bio-Rad, USA) staining ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 2.5-10 µg of each sample was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) through 12% Mini-PROTEAN® TGX™ Precast Gels (4561043, Biorad). After transferring the proteins onto a 0.2 µm Nitrocellulose membrane (Biorad ...
-
bioRxiv - Microbiology 2019Quote: ... the samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using the mini-PROTEAN II cell electrophoresis system (Bio-Rad, USA). The proteins were denatured in 2× loading buffer at 100°C for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of protein were loaded on 10% or 4-15% sodium dodecyl sulfate polyacrylamide gels (Fast Cast TGX Stain-Free or 4-15% Mini-Protean TGX Stain-Free gels, BioRad, Hercules, CA). Blotting was done on PVDF membranes using a BioRad Transblot system ...
-
bioRxiv - Cell Biology 2021Quote: ... Equal amounts of cellular proteins were resolved on 10% or 12% sodium dodecyl sulfate – polyacrylamide gels (SDS-PAGE) and subsequently transferred to nitrocellulose membranes (Bio-Rad Laboratories). Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were run on denaturing sodium dodecylsulfate-polyacrylamide gel electrophoresis gels (12%) before transferring onto Immuno-Blot™ polyvinylidene fluoride membranes (Bio-Rad). The reference protein β-actin was used as a loading control.
-
bioRxiv - Microbiology 2022Quote: ... Milli-Q water was treated with Chelex 100 resin 100–200 mesh sodium form via batch method (50 g/L, Bio-Rad Laboratories). A concentrated stock of SD media not containing Cu2+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amount of protein from different samples and 5-μl of Odyssey One-Color Protein Molecular Weight Marker (LiCore Cat# 928-40000) were resolved on 4—15% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE, Biorad Cat#4561086) then the protein was transferred to a nitrocellulose membrane at 4 °C overnight at 30 volts ...
-
bioRxiv - Plant Biology 2019Quote: ... Ten microliters of the cell extract was subjected to 4-20% sodium dodecyl sulfate polyacrylamide electrophoresis gels (SDS-PAGE, Bio-Rad, CA). SDS-PAGE containing proteins were transferred onto PVDF membranes (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... Total 20 to 25 μg of protein samples were resolved by sodium dodecyl sulfate polyacrylamide electrophoresis (SDS-PAGE; Bio-Rad, Madrid, Spain) followed by Western blot ...
-
bioRxiv - Cancer Biology 2020Quote: ... The protein samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) and transferred to a nitrocellulose membrane (Bio-Rad, Canada). The expression levels of ABCB1 ...
-
bioRxiv - Genetics 2021Quote: ... A total of 20 μg protein was separated with 12% (vol/vol) sodium dodecyl sulphate (SDS)-polyacrylamide gel and electrophoretically transferred onto a polyvinylidene difluoride membrane (Bio-Rad, L1620177). The membrane was soaked with 5% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... the proteins were separated on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, USA). The blots were blocked in 5% BSA in Tris-buffered saline with Tween 20 (TBST ...
-
bioRxiv - Molecular Biology 2023Quote: ... 25-40μg of protein was run on 7.5-15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred using the Trans-Blot Turbo system (Biorad, Hercules, CA) to nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein samples (∼15 μg) were loaded and separated on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, Bio-Rad, Hercules, CA), and transferred to polyvinilidene difluoride membranes (PVDF ...
-
bioRxiv - Neuroscience 2023Quote: ... were loaded onto 4%–12% sodium dodecyl sulfate–polyacrylamide gels (Absin, China) for 40 min using an electrophoresis apparatus (Bio-Rad, USA) and transferred to polyvinylidene difluoride membranes (Millipore ...
-
bioRxiv - Biochemistry 2023Quote: The histones containing residue-specific acetylations or the nucleosomes used for the acetyltransferase activity assay were electrophoresed in a 10–20% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) (DRC, NXV-396HP20) and transferred onto a nitrocellulose membrane (BIO-RAD, 1620112) at 20 V for 10 min by the semi-dry method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 40–50 μg of cell lysate were loaded in precast SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis) gels (Biorad #456-8096) and then transferred onto nitrocellulose membrane by Trans-Blot Turbo Transfer Pack (Biorad #170-4157) ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 20 μg of protein from each lysate were resolved on 10% or 12% sodium dodecyl sulphate – polyacrylamide gels (SDS-PAGE) and subsequently transferred to nitrocellulose membranes (Bio-Rad Laboratories). Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the samples were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and were transferred to a polyvinylidene fluoride (PVDF) membrane (Bio-Rad, USA) using a semidry electrophoretic apparatus ...
-
bioRxiv - Genetics 2024Quote: ... The pulled down proteins were separated by Sodium dodecyl sulfate Poly-Acrylamide Gel Electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories). Membranes were incubated with anti-ACTB (Proteintech ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Biophysics 2021Quote: ... one aliquot of Amberlite XAD-2 (BioRad) was added and allowed to incubate for 1 hour ...
-
bioRxiv - Cell Biology 2019Quote: ... and 2% bis-acrylamide (Bis) (1610142, Biorad) which resulted in different modulus of the PA gels ...
-
bioRxiv - Cell Biology 2020Quote: ... Bio-Beads SM-2 Adsorbents from Biorad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 50 mg of Biobeads SM-2 (BioRad) were added to remove detergent and promote protein insertion into liposomes ...