Labshake search
Citations for Bio-Rad :
351 - 400 of 3532 citations for 6 Chloro 9 fluorobenz 9 isoquinoline 5 10 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... The adaptor was cleaned up on a Micro Bio-Spin 6 chromatography column (Bio-Rad) equilibrated with water ...
-
bioRxiv - Microbiology 2019Quote: ... Excess [γ-32P] ATP was removed with a Bio-Spin 6 column (Bio-rad, CITY). Followed by heat inactivation ...
-
bioRxiv - Biochemistry 2022Quote: ... with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad). The protein concentration and purity were verified by Bradford Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... 10mM BME) at room temperature using Micro Bio-Spin 6 columns (Bio-Rad CAT# 7326200). PARLSkd3 concentration was measured via A280 and the molar extinction coefficient and PARLSkd3 concentration was adjusted to 30 μM ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 1:6 and run with iTaq Universal SYBR Green Supermix (Bio-Rad) on ViiA 7 Real-Time PCR System according to manufacturer protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... 10% SDS and 250 mM Tris-Cl pH 6.8) for 10 minutes prior to SDS-PAGE separation (Bio-Rad, 10% acrylamide, 150 V) for subsequent analysis by either Coomassie staining or blotting on nitrocellulose ...
-
bioRxiv - Microbiology 2021Quote: ... boiled at 95°C for 10 min and loaded on 10% gels (Bio-Rad) for electrophoresis ...
-
bioRxiv - Neuroscience 2020Quote: ... Each sample was mixed 1:1 (10 μl + 10 μl) with Laemmli buffer (BioRad) and boiled at 95°C for 5 min before loaded onto a 4-12% SDS/PAGE gel and run at 200 V before electrotransferred to a membrane using Transblot-Turbo Transfer system (BioRad) ...
-
bioRxiv - Physiology 2021Quote: ... Precast 10% or 4-20% mini-PROTEAN TGX 10-well gels (Bio-Rad, 4561034) were used for protein separation electrophoresis ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Proteins (10-50 µg) were loaded onto 10% sodium dodecyl sulfate polyacrylamide gel (BioRad), separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10%-gels (Bio-Rad, Bulletin_6201) were cast in a PROTEAN Plus multi casting chamer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 10% donkey serum (Biorad) for three hours at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10% Criterion TGX gels (BioRad) in Tris-glycine-SDS running buffer or 3-8% Criterion XT Tris-acetate gels (BioRad ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Membranes were washed 5 time for 5 minutes with PBST and incubated with horseradish peroxidase (HRP) conjugated secondary antibodies (Biorad) for 2 hours at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Plant Biology 2019Quote: 5 % Mini-PROTEAN TBE precast gels (Bio-Rad) have been pre-electrophoresed in 0.5x TBE buffer for 60 minutes at 70 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... loaded onto a 5% polyacrylamideTBE gel (Bio-Rad) that had been pre-run for 15 minutes in TB Buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% powdered milk (Bio-Rad 170-6404) resuspended in 1x TBST ...
-
bioRxiv - Genomics 2019Quote: ... Blocked membrane in 5% Blotting-Grade Blocker (BioRad) in TBS-T (50 mM Tris pH 7.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...