Labshake search
Citations for Bio-Rad :
351 - 400 of 4760 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 5-μg/mL of sheep IgG (Biorad) and purified TNP (BD Pharmingen) ...
-
bioRxiv - Physiology 2023Quote: ... 5 μl SYBR Green mastermix (iTaq, Biorad) and 4 μl cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in 5% blocking buffer (Bio-Rad), blotted in primary and secondary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing 5% of nonfat milk (BIO-RAD). TBS-T buffer was used for all the membrane washings ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-FLAG M2 (F1804 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked in 5% milk (Biorad) or 3% BSA (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 ul of diluted cDNA (1:40 dilution rate) were used for each reaction with 5 ul SsoAdvanced Universal SYBR® Green Supermix (BIO-RAD) and 1 ul of primer mix (5uM) ...
-
bioRxiv - Microbiology 2020Quote: Two hundred µL of overnight bacterial cultures were transferred 5 mL of a 1:10 dilution of TSB medium (Bio-Rad, USA) supplemented with 1 mg mL-1 L-tryptophan and incubated at 30°C overnight (Gordon & Weber 1951) ...
-
bioRxiv - Immunology 2021Quote: ... Livers were paraffin-embedded and immunohistochemistry was performed on 5-micrometer sections using F4/80 antibody clone Cl:A3-1 (BioRad Cat. No. MCA497) and the VECTASTAIN Elite ABS HRP kit (Vector Laboratories ...
-
bioRxiv - Immunology 2020Quote: ... Conjugate DNA was measured by qPCR amplification from 1 μL of lysate in a 10 μL reaction containing 5 μL of iTaq Universal SYBR Green Supermix (Bio-Rad, 1725125) and 5 pmol of each primer (Supplementary Table 1) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The blocking buffer was removed and 10 ml 5% BSA-PBST with 1 μl RABBIT anti-DYKDDDDK Tag antibody (Bio-Rad, # AHP1074), 1 μl anti-MBP Monoclonal Antibody (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were blocked in 5% BSA for 60min at RT and incubated with the primary antibody (anti-NP, Bio-Rad, 1/5000) for 45-60min shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were transferred to a nitrocellulose membrane using the iBlot 2 device and membranes were blocked for 1 hour at RT in 5% (w/v) Blotting Grade Blocker/PBS (Biorad, #170-6404). GCase was detected using rb mAb to hGBA antibody (abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were then rinsed 3 times with PBS to ensure the complete removal of glutaraldehyde and blocked for 1 h in blocking buffer (5% milk (Bio-Rad #1706404) in Tris-Buffered Saline (TBS ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then blocked for 1 hour in 5% non-fat milk in PBS containing 0.1% Tween 20 (Bio-Rad, Hercules, CA) at room temperature ...
-
bioRxiv - Plant Biology 2024Quote: ... The qPCR reaction was carried out on 2μL of 1/5-diluted cDNA using 2X SSoAdvance SYBR Super Mix (Bio-Rad, Hercules CA) with locus-specific primers (Table S2).
-
bioRxiv - Synthetic Biology 2024Quote: ... the membrane was washed using TBST and incubated for 1 h in a 1:20,000 dilution in 5 % milk of Immun-Star Goat Anti-Mouse (GAM)-HRP conjugate from Bio-Rad (Ontario Canada). Three washes were done ...
-
bioRxiv - Cell Biology 2024Quote: A total of 10 µg of protein was combined with 5 µL of Laemmli buffer (1:9 β-mercaptoethanol [PCS 1610710, Bio-Rad] to Laemmli sample buffer [PCS 161-0737 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were blocked with 3% nonfat dry milk (BioRad 1706404) in 1X PBST for 30 min at room temperature and incubated with the GAPDH antibody (Cell Signaling Technology 2118 ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and transcript quantification (QuantStudio 3, Bio-Rad Laboratories Inc., Hercules, CA) were performed as previously described (29).
-
bioRxiv - Cell Biology 2024Quote: ... in a Mini-PROTEAN®3 System (Bio-Rad, Hercules, CA). After electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: ... After three washes (5, 10, 15 minutes) the blot was incubated for 60 minutes with secondary Goat Anti-Rabbit-HRP (Bio-Rad, 1:7000) and Alexa 647 Goat-Anti-Mouse antibodies (Molecular Probes ...
-
bioRxiv - Cell Biology 2020Quote: ... transferred to 0.2 μm pore-size PVDF membranes, and blocked for 1 hour in blocking buffer (5% milk, 0.1% Tween-20 in 1x TBS (Bio-Rad, Hercules, CA, USA)) ...
-
bioRxiv - Cell Biology 2022Quote: ... Then membranes were washed 3 times with TBS-T and incubated with goat anti-mouse or anti-rabbit IgG HRP-conjugated secondary antibody (1:10000 in 5% BSA TBS-T, Bio-rad; #1706515, #1706516) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... in 1× TBS for 5–10 min at room temperature to visualize DNA and mounted with FluoroGuard anti-fade reagent (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2023Quote: ... Mixed samples were immediately centrifuged at 200 x g for 5 mins and 20 μl of the supernatant was transferred into 1 ml Bradford reagent (Bio-Rad, CA, USA) in 1.5 ml tubes ...
-
bioRxiv - Cell Biology 2024Quote: A total of 10 µg of protein was combined with 5 µL of Laemmli buffer (1:9 β-mercaptoethanol [PCS 1610710, Bio-Rad] to Laemmli sample buffer [PCS 161-0737, Bio-Rad]) and sufficient water to reach a final volume of 20 µL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...