Labshake search
Citations for Bio-Rad :
3901 - 3950 of 6638 citations for 10 14 Cadinene 4 5 Diol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Equal inputs of the samples were run on a 4-20% Mini-PROTEAN TGX precast gel (BIO-RAD 4561094) at 180 V for 40 minutes in manufacturer recommended running buffer (25 mM Tris ...
-
bioRxiv - Physiology 2024Quote: ... 50 μg of protein was loaded with Laemmli buffer into 4-15% precast polyacrylamide gels (Bio-rad, Cat#5671083) and subjected to 130V for electrophoresis ...
-
bioRxiv - Genetics 2024Quote: ... at 4°C in a cold room using transfer stacks (from Trans-Blot Turbo RTA kit, Bio-Rad, 1704272). Next ...
-
bioRxiv - Bioengineering 2024Quote: ... The eluted proteins were resolved on 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad, 4561094) and transferred onto 0.45 µm PVDF membranes (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: An equal amount of total protein was resolved on precast 4%–12% SDS-PAGE gels (Biorad, Hercules, CA, USA), and the protein was transferred onto PVDF membranes as previously described 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... onto gradient Bio-Rad 4-20% polyacrylamide SDS-PAGE gels containing StainFree total protein stain (Bio-Rad, 456-8095) and run at 125V in SDS-PAGE running buffer (250.1 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... 15ug of protein were loaded and ran in 4–20% Mini-Protean TGX precast protein gels (Bio-Rad, 4561094) in Tris-Gly-SDS buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50 mg lysate as input for each condition were loaded onto 4%–15% TGX gels (Bio-Rad, Hercules, CA). Proteins then were transferred onto nitrocellulose membrane and blotted with antibodies against proteins of interest ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each fraction of the C-DGUC purified sEVs (37.5 μL) was mixed with 12.5 μL of 4 × Laemmli Sample Buffer (Bio-Rad) and 10% 2-Mercaptoethanol (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were boiled before being subjected to SDS-PAGE on Mini-PROTEAN TGX Precast Gel 4-15 % (Biorad, 4561086). Western blot using anti-SUMO antibody (non-commercial ...
-
bioRxiv - Cell Biology 2024Quote: ... 20µg protein of each processed sample was loaded per well on 4-20% Criterion TGX SDS-PAGE gels (Biorad) for electrophoresis ...
-
bioRxiv - Plant Biology 2020Quote: ... were resolved on 10-12% acrylamide SDS-PAGE gels (Mini protean, Bio-Rad, USA) and transferred onto nitrocellulose membranes (Immobilon-P ...
-
bioRxiv - Cell Biology 2020Quote: ... 10-50ug of total protein sample was mixed with 4x Laemmli buffer (Bio-Rad) and heated at 98 °C for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell extracts were resolved using pre-cast SDS-PAGE (7.5% and 10%) from BioRad and transferred to nitrocellulose membrane using a transfer apparatus according to the manufacturer’s instructions (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... 0.1 mM EDTA and 10% glycerol) with P-30 gel chromatography columns (Bio-Rad). Increasing concentrations (0.1-1.25 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... ddPCR mix contained: 10 µl of QX200™ ddPCR™ EvaGreen Supermix (Bio-Rad), 4 µM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred to an absolute methanol-activated (10s) PVDF membrane (Bio-Rad 1620177) at 100 V for 1 hr in 4°C pre-chilled 1X Tris-Glycine buffer (Bio-Rad 161-0734) ...
-
bioRxiv - Biochemistry 2021Quote: ... The collected fractions were analyzed by SDS-PAGE (10% polyacrylamide precast gel, Bio-Rad) stained with Coomassie blue ...
-
bioRxiv - Biochemistry 2021Quote: ... Pre-cast 10% polyacrylamide gel Mini-PROTEAN TGX were purchased from Bio-Rad (USA).
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of total protein per sample were mixed with Laemmli buffer (#1610737, Biorad) containing 5% DTT (646563-10X ...
-
bioRxiv - Cell Biology 2021Quote: ... pre-cast 10% mini-Protean® TGX SDS-PAGE mini-gels were from Biorad, UK ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg of gp145 were separated in a 10% Mini-Protean TGX Gel (BioRad). The SDS-PAGE gel was then stained for 1 hr with Coomassie Brilliant Blue R-250 dye and destained overnight in 50% methanol and 10% acetic acid ...
-
bioRxiv - Biochemistry 2020Quote: ... and loaded onto with a volume of 10 mL column (Bio-Rad, Lab., Inc.) and buffer exchange done manually ...
-
bioRxiv - Neuroscience 2021Quote: ... and 10 μg of protein in 1X Laemmli sample buffer (Bio-Rad:161-0747) were loaded onto 4-15% Criterion TGX gels (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... for 10 min using the semi-dry Trans-Blot Turbo Transfer System (Bio-Rad). Non-specific binding was blocked with Odyssey® Blocking Buffer (Li-Cor ...
-
bioRxiv - Cancer Biology 2020Quote: ... proteins were loaded onto 10% SDS-polyacrylamide gels and blotted onto PVDF sheets (BioRad) using TurboBlot technology (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... were separated by 10 % SDS– PAGE and transferred to a nitrocellulose membrane (Bio-Rad). Haptoglobin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 67.1 and 70°C for 10 min in a C1000 TouchTM Cycler (Bio-Rad) and measuring the enzymatic activity with the Mu-NANA assay ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture (20 µL) contained 10 µL iQ SYBR Green Supermix (Bio-Rad), 2 µL each of forward and reverse primers to a final primer concentration of 100 nM each except for the assay for L ...
-
bioRxiv - Microbiology 2020Quote: ... fractionated samples were loaded onto precast 10% Mini-PROTEAN® TGX™ gels (BioRad). Gels were blotted using the Trans-Blot Turbo Transfer system (Biorad ...
-
bioRxiv - Biophysics 2021Quote: ... The resin was packed in an Econo-column (Bio-Rad, 1.0 x 10 cm) and washed with high salt buffer (50 mM HEPES ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30μg of total protein was resolved on 10% precast SDS-PAGE gel (Bio-Rad) and transferred to a methanol-preconditioned PVDF membrane by wet transfer for 90 minutes at 100V ...
-
bioRxiv - Cancer Biology 2021Quote: ... protein-bound beads were transferred to a 10-mL chromatography column (Bio-Rad 7311550) and washed with the following buffers ...
-
bioRxiv - Biochemistry 2022Quote: Analytical SEC was performed using an ENrich 650 10/30 column (Bio-Rad, USA) pre-equilibrated in running buffer (25 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... the reactions were quenched by adding 10 μL 2x Laemmli sample buffer (Bio-Rad). The samples were then loaded onto a 4-20% Mini-PROTEAN TGX Precast Protein gel (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... The sample was concentrated by Pall centrifugal device with MWCO 10 kDa prior to loading onto Enrich 70 column (BioRad) previously equilibrated with Buffer A for further purification ...
-
bioRxiv - Biochemistry 2022Quote: A Superdex 75 10/300 GL column installed on an NGC Chromatographic System (BioRad) and equilibrated with the sample buffer (25 mM Tris–HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.025% SDS & 10% methanol (vol/vol) in Trans-Blot Turbo Transfer System (Bio-Rad). After incubation with 5% nonfat milk in TBST (50 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... was loaded into wells of 10% Mini-PROTEAN TGX Precast Protein Gels (Bio-rad), submersed in running buffer (Bio-rad) ...
-
bioRxiv - Microbiology 2021Quote: ... the reaction was quenched by adding 10 µL 2x Laemmli sample buffer (Bio-Rad). The samples were then loaded onto a 4-20% Mini-PROTEAN TGX Precast Protein gel (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were used for SDS-PAGE analysis using precast 10% TGX gels (Bio-Rad). Gels were run in tris-glycine SDS (TGS ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 ng of template DNA was combined with 10 µL iQ supermix (Bio-Rad) and 2 µL each of 20 µM F primer ...
-
bioRxiv - Immunology 2020Quote: ... 16 µl PCR mix (containing 10 µl SYBR green mix (2x) (BioRad, Hercules, USA), 0.6 µl forward and reverse gene-specific primer (10 µM ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR reaction contained 10 μL of 2x QX200 ddPCR EvaGreen Supermix (Bio-Rad), 100 nM forward primer (CTTCTTGCATTCTCCTCATTTCCTC ...
-
bioRxiv - Neuroscience 2020Quote: A 20 μl reaction volume containing 10 μl of 2X iQ Multiplex Powermix (Biorad), 0,60 μl of primers (10 μM) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 µl SsoAdvanced universal SYBR® Green supermix (2x) (Biorad Laboratories GmbH, Munich, Germany), 10 pmol of each primer (forward and reverse) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The products were separated on native 10% polyacrylamide gels (acrylamide: bisacrylamide 19:1, Biorad). The gels were then dried and exposed to storage phosphor screens (GE Healthcare) ...
-
bioRxiv - Systems Biology 2021Quote: ... pH = 7.4) and 10 μl of SDS-PAGE Sample Buffer (CAT # 161-0747, BioRad), to a final SDS concentration of 1% ...
-
bioRxiv - Molecular Biology 2021Quote: Samples were run on 10% Bis-Tris gels and transferred to nitrocellulose membrane (Biorad). Proteins were detected by Western blotting using antibodies against either tag or protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... The beads were transferred to 10 ml columns (Poly-Prep Chromatography Column, Bio-Rad) and eluted with LFB1/50 supplemented with 250 mM imidazole.