Labshake search
Citations for Bio-Rad :
3701 - 3750 of 5608 citations for Mouse Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... was used to remove DNA contaminations and the iScript TM cDNA synthesis kit (Bio-Rad Laboratories) was used for RNA reverse-transcription.
-
bioRxiv - Microbiology 2020Quote: ... Protein bands were visualized using SuperSignal West Pico Chemiluminescent Substrate kits (Bio-Rad, Hercules, CA, USA) and quantified by densitometry using ImageJ software (NCBI ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were visualized using the chemiluminescence detection kit Clarity ECL Western Blotting Substrates (Bio-Rad) in an Alliance Q9 Advanced machine (Uvitec).
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized by reverse-transcription using an iScript™ cDNA Synthesis Kit (Bio-Rad; www.biorad.com). Quantitative Real-Time PCR was performed using a SensiFAST™ SYBR® No-ROX Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... The qRT-PCR assay was done using the iTaq kit according to the manufacturer’s instructions (BioRad). Oligos for the qRT-PCR reactions are shown in table 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 750ng RNA using the iScript cDNA Synthesis Kit (Bio-Rad: 170-8890) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 500ng of RNA was used for cDNA synthesis with iScript cDNA synthesis kit (Bio-rad, 1708890). Transcripts of spx1 (F- TGCCGCCTCTACAGTTAAATGGC ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Genetics 2021Quote: ... Genotyping was performed by ddPCR using the ddPCR Supermix for Probes (No dUTP) kit (Bio-Rad) and the following primer and probe sets ...
-
bioRxiv - Genomics 2019Quote: ... and 500 ng of total RNA was reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad). qRT-PCR quantification of HIPK-1 ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad). Signals obtained by qPCR were normalized to those for 18S unless otherwise noted.
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 μg) was reverse transcribed using an iScript gDNA Clear cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed with SYBR green (SsoAdvanced ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was reverse transcribed from RNA samples using the iScript cDNA Synthesis Kit (Biorad, Hercules, CA) according to the recommended reaction protocol on the ProFlex PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesised from 2 µg purified RNA using iScript™ cDNA Synthesis Kit (Bio-Rad) and quantified by qRT-PCR using iTaq™ Universal SYBR® Green Supermix ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentration in lysates in urea buffer was quantified with a Bradford Protein assay kit (Biorad) and lysates in RIPA buffer with BCA protein assay kit (Pierce) ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were measured using the DCTM Protein Assay Kit I from Bio-Rad (cat # 5000111) by following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 ng RNA was used for cDNA synthesis using the iScript cDNA Synthesis Kit (BIO-RAD) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was collected and estimated for protein concentration using DC protein assay kit (Bio-Rad). For immunoblotting ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Protein concentration in the supernatant was measured using DC™ Protein assay kit (BIO-RAD, UK) according to manufacturer’s specifications using bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cDNA was generated from the RNA samples using an iScript kit (BioRad, Hercules, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... scATAC-Seq libraries were prepared using the SureCell ATAC-Seq Library Prep Kit (17004620, Bio-Rad) and SureCell ATAC-Seq Index Kit (12009360 ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein concentration was determined using the Bio-Rad DC™ Protein Assay Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and cDNA was prepared from samples with RIN > 6.0 using the iScript cDNA Synthesis Kit (BioRad). Gene expression was analyzed with SYBR-based reagents on a StepOne Plus Machine (Applied Biosystems) ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA (1 mg) was reverse-transcribed using iScript select cDNA synthesis kit (Bio-Rad, USA) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was reverse-transcribed to obtain cDNA using the iScript cDNA synthesis kit (Bio-Rad, 1708891), and qPCR was performed using PowerUp SYBR Green Master Mix (ThermoFisher ...
-
bioRxiv - Pathology 2022Quote: ... we mixed the obtained cDNA with the SsoAdvancedTM Universal SYBR® Supermix kit (Bio-Rad, USA). After that ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was then prepared from 100 ng RNA using the iScript cDNA synthesis kit (Bio-Rad). qRT-PCR reactions were set up with 4 biological replicates ...
-
bioRxiv - Microbiology 2022Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad). Signals obtained by qPCR were normalized to those for 18S unless otherwise noted ...
-
bioRxiv - Developmental Biology 2022Quote: ... First-strand cDNA was generated from 1 μg total RNA using the iScript cDNA kit (BioRad) with a poly-T primer as described in the kit’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 250 ng of RNA using the iScript cDNA synthesis kit (Bio-Rad) (40 min ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was synthesized from total RNA (1.0 μg) using iScript cDNA Synthesis Kit (BioRad, Hercules, CA) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... and the Aurum™ Total RNA Mini Kit (catalogue #732-6820, Bio-Rad, Hercules, CA, U.S.A.). In addition ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 μg of RNA was used to synthesize cDNA using iScript cDNA Synthesis Kit (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was converted into cDNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... quantitative PCR was conducted to analyze the extracted DNA using QuantiFast SYBR Green PCR kit (Biorad) with universal 16S rRNA primers 8F ...
-
bioRxiv - Microbiology 2020Quote: ... and used directly for quantitative PCR (qPCR) analysis with the SYBR green qPCR kit (Bio-Rad) on a QuantStudio3 real-time PCR machine ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein content was determined using a commercially kit (Protein Assay Dye Reagent; Bio-Rad, CA, USA) and bovine serum albumin as a standard (Bradford ...
-
bioRxiv - Microbiology 2020Quote: ... were used for detection using the enhanced chemiluminescence detection kits Clarity and Clarity Max ECL (Biorad).
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative RT-PCR was performed using the iTaq Univer SYBR Green 1-Step Kit (Bio-Rad) on a StepOnePlus Real-time PCR system (Applied BioSystem) ...
-
bioRxiv - Neuroscience 2020Quote: ... and protein concentration of the supernatant was quantified using the DC protein quantification kit (Bio-Rad). Samples were stored at -80 °C until array analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse-transcribed to complementary DNA (cDNA) using a iScript cDNA synthesis kit (Bio-Rad, CA).19 Polymerase Chain Reaction was performed using qPCR master-mix (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... and then developed and visualized by reaction with chemiluminesence reagent (Clarity Western Blotting Substrates Kit, BioRad) on radiography film (Carestream Blue X-ray film) ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... cell extracts were quantified with the Bradford-based Protein Assay kit (Bio-Rad Protein Assay, #5000006). After addition of 6X Laemmli buffer (375 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were transferred on to nitrocellulose membranes using the Biorad Trans-blot transfert system kit (Biorad) according to the supplier technical recommendation (7 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs were synthesized from 500 ng total RNA with the iScript cDNA Synthesis Kit (Bio-Rad). cDNAs were subjected to real-time PCR with the SYBR Green Fast Kit (Applied Biosystems) ...