Labshake search
Citations for Bio-Rad :
3651 - 3700 of 7957 citations for Myeloperoxidase MPO Human ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). The samples were separated by SDS-PAGE ...
-
bioRxiv - Immunology 2022Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). Samples were run on NuPAGE 4 to 12% ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cDNA synthesis was performed using iScript gDNA Clear cDNA synthesis kit (Bio-Rad) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Extracted proteins were further purified using the BioRad ReadyPrep 2-D Cleanup Kit (BioRad), approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad ...
-
bioRxiv - Plant Biology 2022Quote: Protein amounts were determined using the Bradford Assay Kit (Bio-Rad, Hercules, California, USA), and 6.0 μg of each protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Plant Biology 2022Quote: ... The total protein concentration was determined using a Bradford protein assay kit (Bio-Rad). Proteins were detected using anti-GFP (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... The total protein concentration was determined using a DC Protein Assay Kit (Bio-rad). For protein separation ...
-
bioRxiv - Microbiology 2022Quote: ... and the plasmid DNA was isolated using Quantum Prep®Plasmid Midiprep Kit (Biorad) according to the manufacturer’s’ instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Total protein amount was determined by DC™ Protein Assay Kit II (Bio-Rad), then lysates were loaded on 4-15% Mini-PROTEAN TGX Stain-Free Protein Gels (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was synthesised with the iScript cDNA Synthesis kit (#1708891, Bio-Rad Laboratories) according to the manufacturers’ instructions ...
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Physiology 2023Quote: ... Purified total RNA was reverse transcribed using an iScript cDNA Synthesis Kit (Bio-rad). Real-time quantitative PCR analysis was performed on a CFX Connect Real-Time System (Bio-rad ...
-
bioRxiv - Genomics 2022Quote: ... and reverse transcribed to cDNA using iScript cDNA synthesis kit (Bio-Rad, Cat# 1708891). TaqMan gene expression assays HS00174286_m1 and HS01561006_m1 were used to quantify the expression of TNFSF8 and FKBP5 genes in each sample ...
-
bioRxiv - Immunology 2022Quote: ... the protein concentration was measured using a DC Protein Assay Kit II (Bio-Rad). The cell lysate was denatured at 75 °C for 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations were determined by DC Protein Assay kit (Bio-Rad; Hercules, CA, USA) according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: 1µg of purified RNA was reverse transcribed using iScript cDNA synthesis Kit (BioRad, #1708891). For secondary structure sensitive reverse transcription reactions (Figure 2E and F) ...
-
bioRxiv - Molecular Biology 2022Quote: ... purification and cDNAs were synthesized with iScript™ cDNA synthesis kit (1708841, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Physiology 2022Quote: It was performed using the kit iScriptTM cDNA synthesis (Bio-Rad, cat. no 1708890). 500 ng of RNA were mixed with 2 µl of 5X iScript Reaction Mix and 0.5 µl of the enzyme iScript Reverse transcriptase in a volume of 10 µl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cDNA synthesis was done by iScript™ cDNA Synthesis kit (Cat #1708891, BIO-RAD) in each condition ...
-
bioRxiv - Physiology 2023Quote: ... supernatant was retained and protein quantified with the DC Protein assay kit II (Biorad). Proteins samples (1.5µg and 3µg of proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription was performed with iScript™ Advanced cDNA Synthesis Kit (BioRad, NSW, Australia) and the PCR was performed with PrimePCR SYBR® Green Assays (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by cDNA preparation using the BioRad iScript cDNA Synthesis kit (BioRad; Cat #:1708891). cDNA was subsequently purified with AMPure XP beads (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Protein concentration was measured using the DC Protein Assay Kit II (5000112, Bio-Rad) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a RC-DC kit (Biorad Lab., Hercules, CA, USA) according to the manufacturing protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... 200ng of totalRNA sample was reverse transcribed with iScript cDNA synthesis kit (Bio-Rad) and quantitative PCR (q-PCR ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was reverse-transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad; 1708891). GoTaq quantitative PCR (qPCR ...
-
bioRxiv - Systems Biology 2024Quote: ... and the protein was quantified using the BCA Protein Assay Kit (Bio-Rad, USA). Protein digestion was performed with trypsin following the filter-aided sample preparation (FASP ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad; Hercules, CA, USA), according to the manufacturer’s protocol using 1 µg total RNA in 20-µL reactions.
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... whose concentrations were measured using the DC Protein Assay Kit (Lowry method, BioRad, 5000116), following the instructions provided by the manufacturer.
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were revealed using an enhanced chemiluminescence kit (1705061 Bio-Rad, Hercules, California, USA) and the imaging system LAS-4000 mini (GE HealthCare Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using the Bradford Protein Assay kit (Bio-Rad, Hercules, CA). Proteins were separated by electrophoresis on 4-20% SDS-PAGE gels (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... iTaq™ Universal SYBR® Green Supermix kit (cat. #1725124, Bio-Rad Laboratories Ltd.) was used according to the manufacturer’s recommendation with cDNA (diluted 1:10∼20 ...
-
bioRxiv - Immunology 2023Quote: ... Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad), followed by qPCR reactions using SYBR Select Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using an iScript-cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). iTaq Universal SYBR Green Supermixes (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022). Copy numbers were calculated with a regression curve from control RNA transcript standards and normalization to per µg RNA in cortex or per ml CSF ...