Labshake search
Citations for Bio-Rad :
3551 - 3600 of 4847 citations for Monobenzyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg RNA was used for cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA (1 µg) was reverse transcribed using iScript reverse transcription supermix (Biorad, Solna, Sweden). RT-qPCR was performed using a LightCycler 96 and the PowerUp SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Physiology 2023Quote: ... followed by overnight staining with pig specific CD45 antibody (clone K252.1E4, Bio-Rad, 1:200). After secondary ab and DAPI applications ...
-
bioRxiv - Cell Biology 2023Quote: ... 500 ng to 1 µg RNA was reverse transcribed using iScript cDNA synthesis kit (Biorad). RT-qPCR was performed using SsoAdvanced Universal SYBR Green Supermix (Biorad) ...
-
bioRxiv - Immunology 2023Quote: ... diluted 1:15,000 and visualized by enhanced chemiluminescence (Clarity Max western ECL substrate, Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lysates were performed on plates with heated 1× SDS sampling buffer (Bio-Rad, 1610147) and subjected to SDS-PAGE ...
-
bioRxiv - Immunology 2023Quote: ... in 1% BSA/PBST followed by washing and addition of BCIP/NBT substrate (Bio-Rad). Pictures of individual wells were captured using an ImmunoSpot analyzer (CTL).
-
bioRxiv - Neuroscience 2023Quote: ... and then incubated with secondary anti-mouse-Starbright Blue-520 (Bio-Rad# 64456855; 1:2000) and anti-Rabbit-Starbright Blue-700 (Bio-Rad# 64484700 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg total RNA was converted to cDNA using the iScript cDNA synthesis kit (BioRad). RT-qPCR reactions were performed using Fast Sybr Master Mix (ABI ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmids were transformed into Escherichia coli XL-1 blue strain by electroporation (Bio-Rad) for PCM1-c-term-GST recombinant expression ...
-
bioRxiv - Physiology 2024Quote: ... NE) and Starbright Blue 700 goat anti-mouse at 1:5,000 #12004159 from Bio-Rad Laboratories (Hercules ...
-
bioRxiv - Microbiology 2024Quote: ... at a 1:3000 dilution and a secondary goat α-rabbit-HRP antibody (Bio-Rad) at a 1:10000 dilution ...
-
bioRxiv - Molecular Biology 2024Quote: ... A total of 1 µl of supernatant was loaded onto the nitrocellulose membrane (Bio-Rad). After incubation at RT for 30 min to dry ...
-
bioRxiv - Biochemistry 2024Quote: ... The 10% APS solution was made by dissolving 1 g of APS (#1610700, BIO-RAD) in 10 mL water and storing at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg of RNA was reverse-transcribed to cDNA with iScript cDNA Synthesis kit (Biorad). Azure Cielo 6 (Azure Biosystem ...
-
bioRxiv - Genetics 2024Quote: ... the membrane was incubated with the goat-anti-rabbit secondary antibody (1:10,000, Bio-Rad). After incubation ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were utilized: Rat Anti-Myelin Basic Protein (MBP; 1:500, Biorad) and Rabbit Anti-Oligodendrocyte transcription factor 2 (Olig2 ...
-
bioRxiv - Cell Biology 2020Quote: ... X-ray film (Figs 1-5) and the ChemiDoc MP Imaging System (Bio-Rad, cat#17001402) (Supplemental Fig 3).
-
bioRxiv - Microbiology 2021Quote: ... Digested DNA fragments were then subjected to 1% agarose pulsed-field gel electrophoresis (PFGE) (Bio-Rad) using 0.5% Tris/Borate/EDTA (TBE ...
-
bioRxiv - Biochemistry 2022Quote: ... was added for 1 hour and membranes were imaged using Clarity Western ECL Substrate (Biorad, 1705061).
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... We used horseradish peroxidase coupled secondary antibodies (α-mouse and α-rabbit, Bio-Rad, 1:2000). Blots were developed using an enhanced chemiluminescence kit (Amersham ...
-
bioRxiv - Bioengineering 2022Quote: ... or rat anti-F4/80 (rat anti-F4/80 antibody, 1:50, BioRad, MCA497GA, Hercules, CA). Cells were again washed in DPBS and incubated for 1 h at room temperature with Alexa Fluor® 488-conjugated secondary antibody (goat polyclonal antibody to rabbit IgG ...
-
bioRxiv - Immunology 2021Quote: ... with specific primers as listed in Table 1 and iTaq Universal SYBR Supermix (Bio-Rad, USA). The 10 µL reaction consisted of 5.0 µL 2X Supermix ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.1% Tween 20 (TBST) followed by 1hr incubation with secondary antibody in TBST (1:5000, Biorad). Three washes were given for 10 minutes each after the secondary antibody incubation ...
-
bioRxiv - Immunology 2019Quote: ... and a primary rat anti-mouse CD68 antibody (activated microglia/macrophages, 1:200 dilution, MCA1957, Biorad) with secondary goat anti-rat Alexa-Fluor 555 (1:200 dilution ...
-
bioRxiv - Bioengineering 2019Quote: ... according to the manufacturer’s manual using a 1% certified megabase agarose (Bio-Rad Laboratories, Cat. # 1613108) gel in 0.5x Tris-borate-EDTA buffer (TBE) ...
-
bioRxiv - Neuroscience 2019Quote: ... three sections of tissue were stained with antibodies against proteolipid protein (MCA839G; Bio-Rad; 1:1000) and imaged at a spatial resolution of 0.28 µm/pixel ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lysate aliquots with 16 µg protein were denatured in 1× Laemmli sample buffer (Bio-Rad, 1610747) for 5 min at 95°C ...
-
bioRxiv - Microbiology 2019Quote: ... The bead/lysate mixture was allowed to pack in a 1 cm separation column (Bio-Rad) and washed with Wash Buffer (50 mM Na2HPO4 ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was synthesized from 1 µg RNA by using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR (qPCR ...
-
bioRxiv - Biochemistry 2020Quote: ... The absorbance readings were collected at 260nm with a Econo UV Monitor (EM-1 220V, Biorad). After fractionation ...
-
bioRxiv - Neuroscience 2021Quote: ... or Goat Anti-Rabbit IgG (H L)-HRP Conjugate (1:1000; Bio-Rad; Catalog # 172-1019) in TBS-T for 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of RNA was reverse transcribed to cDNA by iScript cDNA synthesis kit (BioRad #17088) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cell Biology 2021Quote: ... The assay medium was prepared by diluting 1 volume of alamarBlue dye reagent (BUF012A; Bio-Rad) in 9 volumes of growth medium ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Microbiology 2020Quote: ... loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1, Bio-rad, 1610148), run at 200V for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... The following secondary antibodies were used: goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, Hercules, CA, United States) with the conditions of 2.5kV ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 μg) was reverse transcribed using an iScript gDNA Clear cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed with SYBR green (SsoAdvanced ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-conjugated Goat Anti-Rabbit IgG (H+L) (1:1000, 170-6515, Bio-Rad, CA, USA) or Goat-anti-Mouse IgG (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... qPCRs were then performed with 1 μl of cDNA using Universal SYBR green Supermix (BIO-RAD). Primer sets used for real-time PCR analysis are qcopA forward (CAATACCCTGGTGGTCGATAAAAC ...
-
bioRxiv - Microbiology 2020Quote: ... and 1: 25000 diluted secondary HRP conjugated Goat anti-mouse IgG (H+L) (BioRad, Mississauga, Canada). The blot was developed using Clarity Western ECL substrate (BioRad ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA (1 mg) was reverse-transcribed using iScript select cDNA synthesis kit (Bio-Rad, USA) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... at 1:3000 dilution and with the ladder conjugate (Precision Protein StrepTactin-HRP Conjugate, Bio-Rad) at 1:5000 dilution ...