Labshake search
Citations for Bio-Rad :
3451 - 3500 of 9194 citations for Glutathione Fluorescent 384 Well Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... and reactions were covered with Microseal ‘B’ PCR Plate Seals (Biorad, CA) to avoid evaporation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates were then imaged using a ChemiDoc™ Touch Imaging System (BioRad), and analysed with an ImageJ ‘colony area’ plug-in developed by (Guzmán et al. ...
-
bioRxiv - Bioengineering 2019Quote: ... The plate was sealed using an optically transparent adhesive seal (Bio-Rad) and briefly spun down on a benchtop centrifuge ...
-
bioRxiv - Bioengineering 2020Quote: ... The plate was sealed with an optically transparent adhesive seal (Bio-Rad) and spun down on a benchtop centrifuge ...
-
bioRxiv - Physiology 2020Quote: ... the plate was immediately placed in an xMark-Microplate spectrophotometer (Bio-Rad) at 30°C ...
-
bioRxiv - Genetics 2019Quote: ... the plate was placed in the C1000 Touch Thermal Cycler (Bio-Rad) for PCR run ...
-
bioRxiv - Genomics 2020Quote: ... The PCR plate was read on the QX200 droplet reader (Bio-Rad) and data were analyzed by QuantaSoft 1.7.4 software (Bio-Rad) ...
-
bioRxiv - Bioengineering 2021Quote: ... the plate was loaded onto the QX200 Droplet Reader (Bio-Rad, 1864003), and QuantaSoft software was used to collect droplet fluorescence data ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Plates were then imaged on a Gel Doc XR+ System (Bio-Rad). Colonies from the plate were also picked and diluted in 20 μL LB media and imaged on a microscope slide to confirm the presence of condensates (as described in “Optical Microscopy”) ...
-
bioRxiv - Microbiology 2020Quote: ... Plate images were obtained using Gel Doc EZ Gel Documentation System (BioRad) and Image Lab (BioRad ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed and the plates read on a Luminex Bio-Plex (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated and imaged (Gel Doc XR+ imaging system, Bio-Rad), at different time intervals ...
-
bioRxiv - Microbiology 2022Quote: ... Plate images were obtained using Gel Doc EZ Gel Documentation System (BioRad) and Image Lab (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... The plate was read at 450 nm using a microplate reader (BioRad).
-
bioRxiv - Cell Biology 2021Quote: ... Plates were air dried and imaged using the ChemiDocTM MP system (BioRad). Individual colonies were counted using ImageJ ...
-
bioRxiv - Genetics 2019Quote: ... PCR plates were transferred to a QX200 Droplet Reader (Bio-Rad Laboratories) to automatically detect the fluorescent signal in the droplets ...
-
bioRxiv - Bioengineering 2020Quote: ... Plates were then sealed with optical tape (iCycler iQ®; Bio-Rad), centrifuged (3000 rcf ...
-
bioRxiv - Microbiology 2019Quote: ... plate images were collected using the Gel Doc EZ Documentation system (BioRad) and Image Lab (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... and heat-sealed with PX1TM PCR Plate Sealer (Bio-Rad, CA, USA). PCR amplification was carried out on a C1000 TouchTM Thermal Cycler with 96-Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... Plates were sealed using a microseal ‘B’ Adhesive Seal (Bio-Rad MSB1001) and the reaction progress was recorded during 40 cycles using a C1000Touch plate reader (Bio-Rad) ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were read on a model 680 microplate reader (Bio-Rad) at 450 nm.
-
bioRxiv - Developmental Biology 2021Quote: ... sealed with optically clear microseal film for PCR plates (MSB1001, Bio-Rad Laboratories - Life Sciences ...
-
bioRxiv - Developmental Biology 2021Quote: ... sealed with optically clear microseal film for PCR plates (MSB1001, Bio-Rad Laboratories - Life Sciences ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the ddPCR plate was placed in the QX200 Droplet Reader (BioRad 1863001) using ddPCR™ Droplet Reader Oil (Bio-Rad 1863004).
-
bioRxiv - Cell Biology 2022Quote: ... plates were read in a 680 microplate reader (Bio-Rad, Hercules CA.) reader plate equipment.
-
bioRxiv - Genomics 2022Quote: ... The reaction was sealed with Microseal ‘B’ PCR Plate Seals (Biorad, CA) and incubated for at least 6h ...
-
bioRxiv - Microbiology 2023Quote: ... cells cultured from GCB/DFO/IPTG plates were inoculated into Chelex (BioRad)-treated defined medium (CDM ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8.2) using a Criterion tank blotter with plate electrodes (1704070; BioRad) set to 70V constant ...
-
bioRxiv - Immunology 2024Quote: ... Droplet plates were subsequently loaded into the QX200 Droplet Reader (Bio-Rad) for fluorescence analysis ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The plate was sealed with a microseal B adhesive (Bio-Rad MSB1001) and incubated in a plate reader with continuous shaking for 18 hr at 37 °C and absorbance measurements at 600 nm every 15 min.
-
bioRxiv - Molecular Biology 2023Quote: ... Plates were placed on a UV to white light conversion screen (BioRad) and backlit with LED lighting for imaging.
-
bioRxiv - Cell Biology 2023Quote: ... Plates were washed using the Bio-Plex wash station (Bio-rad, 30034376) and read on a Bio-Plex 200 system (Bio-rad ...
-
bioRxiv - Microbiology 2023Quote: ... Plate images were obtained using Gel Doc EZ Gel Documentation System (BioRad) and Image Lab (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... All plates were read using an iMark Microplate absorbance reader (Bio-Rad) and processed using GraphPad Prism 6 software.
-
bioRxiv - Microbiology 2023Quote: ... Absorbance was measured at 570nm on a plate reader (BioRad, Watford, UK).
-
bioRxiv - Cancer Biology 2023Quote: ... the plate was loaded in the QX200 Droplet Digital PCR (Bio-Rad) automated system to create the droplets ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plates were loaded into a QX100™ Droplet Reader (Bio-Rad) and each droplet measured on both FAM and HEX channels ...
-
bioRxiv - Biochemistry 2023Quote: ... was prepared and casted into 1.00 mm mini-protean glass plates (Biorad), filling them up to 80% ...
-
bioRxiv - Immunology 2024Quote: ... Plates were then run on CFX384 Touch Real-Time PCR system (BioRad).
-
bioRxiv - Neuroscience 2024Quote: ... Separating gels were cast on BioRad mini-PROTEAN short plates (BioRad, USA). Stacking gels were formulated with 10% acrylamide ...
-
bioRxiv - Neuroscience 2024Quote: ... and plates were read on the CFX384 Real-Time System (Bio-Rad). Data were analyzed via the ΔΔCt method and normalized to either U6 (for miRNAs ...
-
bioRxiv - Cell Biology 2024Quote: ... Plates were imaged on a ChemiDoc MP Imaging System (Bio-Rad Laboratories). Band densitometry analysis was performed using Image Lab 5.0 (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2024Quote: ... and the plate was then blocked with 5% nonfat dry milk (BioRad) in PBS for 3 hours at 37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA was used as template for real-time PCR (primers in Supplemental table 1) using CFV384 Touch™ Real-Time PCR Detection System (Bio-Rad). Housekeeping genes (AT4G34270 ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time RT-PCR using FAST SYBR Green I technology was performed on an CFX96 Touch Real-Time Detection System (Biorad, Feldkirchen, Germany) using standard cycling conditions (15 min 95°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... ATGATAGTAGAGTTGAGTAGCG) and nuclear (GTACCCACCTGTCGTCC, GTCCACGAGACCAATGACTG) genes 105 were used for qPCR on CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Mitochondrial to nuclear DNA ratios were quantified using the ΔΔCt method.
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was run using the SYBR® Green Master Mix on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad). Gene expression was relative to the housekeeping gene Gapdh or Hprt and presented by 2-△Ct 52.
-
bioRxiv - Developmental Biology 2020Quote: ... Membranes were then washed 3 times for 5 min in TBST before detection using Clarity Western ECL Substrate (Bio-rad, 170-5061) and imaging on a ChemiDoc MP (Bio-rad ...
-
bioRxiv - Biophysics 2022Quote: ... pH 7.5 was heated from 15 ºC to 90 ºC with 0.5 ºC increment every 30 seconds on an iCycle iQ5 Real Time Detection System (Bio-Rad, Hercules, CA). The normalized fluorescence data was plotted against temperature (53).
-
bioRxiv - Molecular Biology 2020Quote: ... QPCR was performed using Precision Melt Supermix containing EvaGreen dye (cat# 172-5110) using CFX96 Touch™ Real-Time PCR Detection System (BioRad, USA). Sequences of PCR primers are listed in Table.