Labshake search
Citations for Bio-Rad :
3451 - 3500 of 7869 citations for 11 Ketotestosterone ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... and converted into cDNA with the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad). RT-PCR was performed with RedTaq Polymerase (VWR ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was generated from 1μg RNA using iScript cDNA Synthesis Kit (Bio-Rad, 1708891). qPCR was carried out on a Roche LightCycler 480 (Roche ...
-
bioRxiv - Immunology 2019Quote: ... and 100ng was loaded into the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). For IL21 gene analysis ...
-
bioRxiv - Genetics 2020Quote: Proteins extracted from Drosophila were quantified with BCA Protein Assay kit (Biorad, CA, US), 20μg per sample were prepared with 4x Laemmli Sample Buffer added with β-mercaptoethanol (#1610747 and #1610710 ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by cDNA preparation using iScript cDNA synthesis kit (BIO-RAD, Hercules, CA, USA) as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... DNase-treated RNA was converted to cDNA using the iScript cDNA Synthesis Kit (BioRad). One µl of 1:5 cDNA sample dilutions were used for qPCR reactions ...
-
bioRxiv - Bioengineering 2019Quote: ... Membranes were developed by chemiluminiscence using the Clarity Western ECL Substrate kit (Bio-Rad) and images were acquired using a ChemiDoc Touch system (Bio-Rad).
-
bioRxiv - Genomics 2019Quote: ... refer to the SureCell ATAC-Seq Library Prep Kit User Guide (17004620, Bio-Rad). Tagmented cells or nuclei were loaded onto a ddSEQ Single-Cell Isolator (12004336 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA synthesis was first performed using the iScript™ cDNA Synthesis Kit (Bio-Rad) and 500 ng of isolated RNA per reaction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... for RNA-seq validation and iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) for knockdown experiments ...
-
bioRxiv - Physiology 2020Quote: ... cDNA synthesis were then carried out with the iScript cDNA Synthesis Kit (Bio-Rad). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... T7-tagged templates were generated with the iProof High-Fidelity PCR Kit (Bio-Rad) using sequences cloned into plasmids pIB (LacZ) ...
-
bioRxiv - Genetics 2019Quote: ... Protein concentrations were determined using the DCM Protein Assay Kit BioRad (#500-0116, Biorad).
-
bioRxiv - Immunology 2020Quote: ... RNA was converted to cDNA using the iScript cDNA synthesis kit (BioRad, CA, USA). Gene expression levels were determined using a TaqMan expression assay ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad). Primers were designed to result in a product spanning exons 4-6 of cdipt ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA samples were subjected to reverse transcription using iScript™ cDNA Synthesis Kit (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA synthesis was achieved using iScript™ Advanced cDNA Synthesis Kit (Bio-Rad), according to the manufacturer’s instruction ...
-
bioRxiv - Pathology 2020Quote: ... RNA was then used for cDNA synthesis using the iScript cDNA synthesis kit (BioRad). cDNA templates were used for real-time quantitative PCR with KAPA SYBR Fast qPCR kit (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). End-point PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized from total RNA using iScript Advanced cDNA Synthesis Kit (Bio-Rad). Genomic DNA and cDNA were then genotyped for rs17779352 using a custom Taqman genotyping assay for rs17779352 (ANCE9Z2 ...
-
bioRxiv - Pathology 2020Quote: ... The blots were developed using ECL immunochemical detection kit (Bio-Rad, Richmond, CA, USA) and densitometric analysis was conducted to quantify the Western blot immunoreactivity with a scanner and ImageQuant software (Amersham Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was purified with an Arum Total RNA mini kit (Bio-rad #732-6820). Reverse transcription was carried out using the iScript Advanced cDNA Synthesis kit (Bio-rad #1725037) ...
-
bioRxiv - Microbiology 2020Quote: ... Signals were visualised using the ECL kit (Clarity Western ECL, Bio-Rad, Hercules, California) as suggested by the manufacturer.
-
bioRxiv - Microbiology 2020Quote: ... the protein signals were detected using the ECL detection kit (Bio-Rad, California, USA). Blots were analyzed using Quantity One software (Bio-Rad ...
-
A family of contact-dependent nuclease effectors contain an exchangeable, species-identifying domainbioRxiv - Microbiology 2020Quote: ... and finally developed using Immun-Star HRP substrate kit (Bio-Rad Laboratories, Hercules, CA). Blots were visualized using a Chemidoc (Bio-Rad Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized from total RNA using iScript Advanced cDNA Synthesis Kit (Bio-Rad). Genomic DNA and cDNA were then genotyped for rs398206 using custom Taqman genotyping probe set (ANRWEYM ...
-
bioRxiv - Physiology 2020Quote: ... 500ng mRNA was used for cDNA synthesis using the iScript kit (Bio-Rad, 1708891). Quantitative PCR was performed in triplicate 25 μL reactions using 2X SYBR Green SuperMix (PerfeCTa ...
-
bioRxiv - Developmental Biology 2019Quote: ... and converted into 100-500ng cDNA using the iScript cDNA synthesis kit (Bio-Rad). RT-PCR was performed with 10–100 ng of cDNA template in a 25 μl total reaction volume (12.5 μl iQ SYBR Green Supermix (2× ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Finally ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was carried out using an iScript™ cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed using the iQ™ SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was visualized using the ECL Western Blotting Detection Kit (Bio-Rad, USA).
-
bioRxiv - Developmental Biology 2019Quote: ... Complementary DNA was created by reverse transcription using an iScript cDNA kit (Bio-Rad) following manufacturer’s instructions and using 500 ng of input RNA for each sample ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each analysis was performed in triplicate using iQ SYBR Green Supermix kit (Bio-Rad). Samples were standardized to a RP49 control ...
-
bioRxiv - Physiology 2019Quote: ... mRNA was reverse transcribed with iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA) and quantitative RT-PCR was performed using Ssofast EvaGreen Supermix (Bio-Rad) ...
-
bioRxiv - Genetics 2019Quote: ... then we performed reverse transcription using the iScriptTM cDNA Synthesis Kit (BioRad, Hercules, CA).
-
bioRxiv - Neuroscience 2019Quote: ... The RNA was converted into cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad) following manufacturer's instructions ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using the iScript Advanced cDNA Synthesis Kit (Bio-Rad, Hercules, CA), then preamplified using SsoAdvanced PreAmp Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and the commercially available iScript™ cDNA synthesis kit (Bio-Rad, Gladesville, NSW, Australia) in the presence of random hexamers and oligo(dT)s ...
-
bioRxiv - Immunology 2019Quote: ... Two micrograms of total RNA were reverse transcribed using iScript cDNA synthesis kit (BioRad) in a total volume of 20 μl ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules CA) according to manufacturer’s recommendations using 1.0 µg of purified total RNA.
-
bioRxiv - Genomics 2021Quote: ... refer to the SureCell ATAC-Seq Library Prep Kit User Guide (17004620, Bio-Rad). Tagmented cells were loaded onto a ddSEQ Single-Cell Isolator (12004336 ...
-
bioRxiv - Microbiology 2021Quote: ... The autoradiography signals were visualized using ECL advance Western blotting detection kit (BioRad, USA).
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using the iScript™ Reverse Transcription Supermix kit (Bio-Rad, #1708841).
-
bioRxiv - Physiology 2021Quote: ... Protein concentration in the lysates was estimated using Dc protein assay kit (Bio-Rad). The lysates (30 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... and retro-transcribed into cDNA by iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad, Hercules, CA, USA) and primers listed in Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total protein of the samples was quantified using a Protein DC kit (Bio-Rad). β-Mercaptoethanol and loading dye was added to 125 µg of the samples ...
-
bioRxiv - Immunology 2020Quote: Reverse transcription of RNA was performed utilizing iScript cDNA Synthesis Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized with iScript™ cDNA Synthesis Kit (#170-8891 from Bio-Rad). qPCR was performed using KAPA SYBR® Fast and primers for ITGB1 (5’AGATCCGAAGTTTCAAGGGC3’ and 5’GAACCATGACCTCGTTGTTC3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA was reverse transcribed (RT) using the iScript cDNA synthesis kit (Bio-Rad) in a final volume of 10 μl ...