Labshake search
Citations for Bio-Rad :
301 - 350 of 8087 citations for Urea Nitrogen BUN Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The membranes were then subjected to peroxidase-based detection by using enhanced chemiluminescence (ECL) detection reagent (Clarity Max™ Western ECL Substrate, Bio-Rad), and the chemiluminescent signals were visualized by ChemiDoc Touch System (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2020Quote: Library preparation for RNA extracted from NveAGO1 and NveAGO2 IP was size selected for 18-30 nucleotides on 15% denaturing urea polyacrylamide gel (Bio-Rad) followed by overnight RNA elution in 0.3M NaCl ...
-
bioRxiv - Genetics 2019Quote: ... Samples containing 10 μg of total RNA were separated on 8M urea-containing 8% polyacrylamide gels followed by electroblotting to Zeta-probe membranes (Bio-Rad). The blots were sequentially probed for and using 32P-labeled oligonucleotides (S7 Table) ...
-
bioRxiv - Cell Biology 2020Quote: ... The pellet was resuspended in 10 µl 4M Urea and the protein concentration of both pellet and supernatant was determined by using the method of Bradford (5000006, Bio-Rad). Finally ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Small RNAs were obtained by gel size selection from total RNA using 15% Mini-Protean TBE-Urea Gel (Bio-Rad, #4566056). The gel was run at 300V for 50 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... The immunoprecipitated proteins from three treatments were mixed and either denatured by 9 M Urea/20 mM HEPES buffer or mixed with 2x Laemmli Sample Buffer (1610737, Bio-Rad) and separated by SDS-PAGE to analyze individual fractions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 µg total RNA each from WT and rad6Δ cells was resolved on 15% TBE-Urea polyacrylamide gel (Bio-Rad, #3450091). The RNAs were then transferred onto positively charged nylone membrane (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... The dicing reactions were performed at 37 °C for 30 min and stopped by adding 1 volume TBE-Urea sample buffer (Bio-Rad), heating at 95 °C for 10 min and quickly chilling on ice for 2 min ...
-
bioRxiv - Genetics 2023Quote: ... Reaction mixtures were resolved on a 14% urea-PAGE gel (AmericanBio, Inc.) and analyzed using a PharosFX molecular imager (Bio-Rad). Single-nucleotide extension products were quantified using Image Lab software ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was loaded onto 8 to 12% PAGE–7 M urea gels and transferred to Hybond-N+ (GE) membranes using a Trans-Blot Turbo Transfer system (Bio-Rad) in 1X TBE ...
-
bioRxiv - Developmental Biology 2024Quote: ... miRNAs were separated in 15% denaturing urea polyacrylamide gel in 1X TBE and then were transferred to a Zeta-Probe blotting membrane (Bio-Rad) using a semi-dry Trans-Blot SD (Bio-Rad ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were then separated by 20% Urea-PAGE gel at 250 V for 1 h and the fluorescent signal was captured by the ChemiDoc System (Bio-Rad). For protein detection ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were grown on selective plates at 30°C for 2 days and imaged using a Geldoc system (Bio-RAD). For liquid cultures cells were diluted to OD600 0.15 and incubated at 30°C ...
-
bioRxiv - Microbiology 2020Quote: ... Protoplast suspensions (2 × 108 cells/ml) containing 0.6% low melting agarose gel were added to 50-well dispensable mold plates (Bio-Rad). Plugs were immersed in 10 ml of NDS (1% N-lauroyl sarcosinate sodium salt solution ...
-
bioRxiv - Microbiology 2021Quote: ... was used to detect and quantify SARS-CoV-2 RNA using the SARS-CoV-2 Droplet Digital PCR Kit (Bio-Rad), which contains a triplex assay of primers/probes aligned to the CDC markers for SARS-CoV-2 N1 and N2 genes and human RPP30 gene ...
-
bioRxiv - Neuroscience 2020Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad). Rpl19 mRNA levels were used for normalization and the ΔΔCt method (70 ...
-
bioRxiv - Bioengineering 2022Quote: ... Real-Time PCR Detection System (Bio-Rad Laboratories, California) was used to detect mRNA expression of target genes ...
-
bioRxiv - Cell Biology 2022Quote: ... on a CFX384 Real-Time PCR Detection system (Biorad). Expression of each gene was normalized to the housekeeping gene ALG9 and expressed as fold change after 1.5h rapamycin treatment calculated using delta-delta Ct method.
-
bioRxiv - Molecular Biology 2021Quote: ... and CFX384 Touch Real-Time PCR Detection Systems (BioRad). Relative levels of transcript expression were quantified by the comparative ΔΔCt method with normalisation to RPL19 levels ...
-
bioRxiv - Neuroscience 2019Quote: ... A CFX connect real-time detection system (Bio-Rad) was used to perform qPCR ...
-
bioRxiv - Immunology 2019Quote: ... The CFX384 TouchTM Real-Time PCR Detection System (BioRad) was used to obtain the raw CT values ...
-
bioRxiv - Systems Biology 2019Quote: ... and CFX96 Real-Time PCR Detection System (Bio-Rad) were used for quantitative PCR ...
-
bioRxiv - Cancer Biology 2019Quote: ... using CFX384 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in CFX96TM Real-Time PCR Detection system (Bio-Rad). Ribosomal protein S14 (RPS14 ...
-
Cell culture dimensionality influences mesenchymal stem cell fate through cadherin-2 and cadherin-11bioRxiv - Cell Biology 2019Quote: ... and a Real-Time PCR Detection System (Bio-Rad). The cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). Primer sequences are available upon request.
-
bioRxiv - Microbiology 2021Quote: ... using CFX96 Real-Time PCR Detection System (Bio-Rad) and 500 nM SARS-Cov-2 nsp1-specific CCTCAACTTGAACAGCCCTATG forward and GAATGCCTTCGAGTTCTGCTAC reverse primers.
-
bioRxiv - Biochemistry 2020Quote: ... for detection with the ChemiDocTM XRS+ System (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The CFX96 Real-Time PCR Detection System (Bio-Rad) was used to monitor fluorescent intensity during amplification ...
-
bioRxiv - Plant Biology 2021Quote: ... in a CFX96 Real-Time Detection System (Bio-Rad), using 1 μL of cDNA in a final reaction volume of 10 μL per well ...
-
bioRxiv - Cell Biology 2021Quote: ... Blots were imaged using Western Clarity detection reagent (BioRad) before detection on a BioRad Chemi Doc imaging system with BioRad Image Lab v5.1 software.
-
bioRxiv - Microbiology 2021Quote: ... Detection was performed with ECL (Bio-Rad or Thermo), and images were acquired with a ChemiDoc XRS imaging system (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... in iQ5 Real-Time PCR Detection System (Bio-Rad). A portion of the m-hCDKL5 (Fw 5’-CTTAAATGCAGACACAAGGAAACAC-3 ‘ ...
-
bioRxiv - Microbiology 2020Quote: ... on CFX96 TouchTM Real-Time PCR Detection System (BioRad). The genome sequence of P ...
-
bioRxiv - Cancer Biology 2020Quote: ... on the CFX384 RT-PCR detection system (Bio-Rad). Isoform-specific primers sequences and housekeeping gene primers are shown in the Supplement Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and imaged using the detection solution (BioRad, 170-5061) and ChemiDoc imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... The CFX Connect Real-Time PCR Detection System (BioRad) was used to run RTq-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a Real-Time PCR Detection System (Bio-Rad). Bacterial strains were grown for 2 hours at 37°C under inducing conditions in LB ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... on CFX96 Real-Time PCR Detection System (Bio-Rad). The data were analyzed by the comparative threshold method ...
-
bioRxiv - Physiology 2020Quote: ... real-time detection method (BioRad MyIQ RT-PCR, Thermo).
-
ATM-mediated DNA damage response in macrophages primes phagocytosis and immune checkpoint regulationbioRxiv - Immunology 2020Quote: ... on CFX96TM Real-Time PCR Detection System (Bio-Rad). The cDNA was added to qPCR buffer Master-mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... CFX96 Real-Time PCR detection system (Bio-Rad Laboratories), or CFX384 Real-Time PCR detection system (Bio-Rad Laboratories).
-
bioRxiv - Cancer Biology 2021Quote: Detection was performed using the iQ5 QPCR apparatus (Biorad), using IQ green super mix (Biorad) ...
-
bioRxiv - Microbiology 2022Quote: ... in a CFX96 real-time PCR detection system (BioRad). Specific primers were designed using the PrimerQuest tool (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... CFX Connect Real-Time PCR Detection system (Bio-Rad), Eco Real-Time PCR System (Illumina) ...
-
bioRxiv - Systems Biology 2022Quote: ... Real-time sequence detection software (Bio-Rad Laboratories; 1845001) was used to compute Cycle threshold (CT) ...
-
bioRxiv - Physiology 2019Quote: ... on a CFX384 Real-Time PCR Detection system (BioRad). 2.8 ng cDNA was added to each well ...
-
bioRxiv - Cancer Biology 2019Quote: ... and CFX96 Real-Time PCR detection system (Bio-Rad). The primers used for real-time PCR were designed based on the Universal Probe Library (Roche ...
-
bioRxiv - Immunology 2019Quote: ... in CFX96 Real-Time PCR Detection System (Bio-Rad).