Labshake search
Citations for Bio-Rad :
301 - 350 of 7054 citations for Rat Corticosteroid 11 Beta Dehydrogenase Isozyme 1 HSD11B1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... ELISA-based signaling measurements were performed according to the manufacturer’s instructions (Bio-Rad). The Luminex kits EGFR Y1068-p and p-AKT is S473-p were obtained from Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... detected with rat-anti-rituximab-HRP antibody (MCA2260P, Bio-Rad), and serum levels interpolated using either a rituximab or Ritxumab-U2S3 standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... and the rat monoclonal antibody anti-tubulin (MCA77G; Bio-Rad) diluted 1:1000 in TBSTM ...
-
bioRxiv - Microbiology 2020Quote: ... rat anti-mouse B220/CD45R (clone RA3-6B2; Bio-Rad), after antigen retrieval ...
-
bioRxiv - Immunology 2021Quote: ... Immunohistochemistry with anti-F4/80 rat monoclonal antibody (MCA497GA, BioRad) was used for the quantification of macrophages by counting 3 different fields for each sample ...
-
bioRxiv - Cell Biology 2022Quote: ... rat α-tubulin primary antibody (RID AB_325005, MCA78G, Bio-Rad) was diluted 1:200 in 1X PBS-BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... a rat anti-mouse CD206 primary antibody (Bio-Rad, USA), or a rat anti-mouse F4/80 primary antibody (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... An equal dose of isotype rat IgG1 (Bio-Rad #MCA1209) or rat IgG2a (Bio-Rad #MCA1210 ...
-
bioRxiv - Bioengineering 2022Quote: ... ddPCR reactions were set up as follows: 11 μL 2×ddPCR™ supermix for probes (no dUTP) (BioRad), 0.2 μL FWD primer (100 μM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ddPCR multiplex mix was prepared by adding 11 μl of 2x Supermix for Probes (no UTPs, BioRad), 1.1 μl of all four primers (900 nM) ...
-
bioRxiv - Neuroscience 2024Quote: ... and stained with their respective primary antibodies (Iba1 clone E4O4W, Cell Signaling; and CD68 Clone FA-11, BioRad) in staining buffer (2% Goat Serum ...
-
bioRxiv - Neuroscience 2022Quote: ... then placed in 4% normal goat serum in 0.01M PBS blocking solution for 60 minutes with agitation followed by incubation with rat anti-CD68 (1:500; BioRad, cat no. MCA1957GA) and rabbit anti-MBP (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies used in this study were anti-myelin basic protein (MBP, rat, monoclonal, clone 12, Bio-Rad, cat# MCA409S, 1:1000), anti-Neurofilament 200 (NF200 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4-12% gradient bis-tris gels or 16% tricine gels (Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were reduced in LDS with beta-mercaptoethanol and then polyacrylamide gel electrophoresis was performed on 4-20% Protean Mini TGX gels (Biorad) and transferred to Immobilon PVDF membranes for 15 minutes using mini TGX settings on the Trans-Blot-Turbo system (Biorad) ...
-
bioRxiv - Physiology 2021Quote: ... and proteins were stripped from beads by incubation in gel loading buffer with beta-mercaptoethanol and loaded to 4-15 % gels (Criterion; BioRad) for SDS-PAGE ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and protein concentrations were equalized prior to boiling in the recommended sample buffers supplemented with 2.5% beta-mercaptoethanol (Bio-Rad). SDS-PAGE electrophoresis was performed using 4–12% gradient bis-tris gels (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... The production of carbapenemase was tested by combination disc test method (EUCAST 2017) and biochemical tests (BioRad-Beta-Carba test) while carbapenem hydrolysis was tested by MALDI-TOF (Papagiannitsis et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µl of the ligation product was added to 50 µl of NEB 10-beta competent bacteria and transferred to an ice-cold 0.2 cm Gene Pulser cuvette (Bio-Rad) for electroporation (25 µF ...
-
bioRxiv - Microbiology 2021Quote: ... Absorbance of the suspension was measured at 570nm using ELISA plate reader (BioRad, USA). Cellular cytotoxicity was determined in duplicates and each experiment was repeated thrice independently.
-
bioRxiv - Immunology 2021Quote: ... The absorbance at 450 nm was measured by an ELISA plate reader (Bio-Rad). The endpoint serum dilution was calculated with curve fit analysis of optical density (OD ...
-
bioRxiv - Immunology 2023Quote: ... The plates were developed with TMB ELISA substrate solution (Bio-Rad Laboratories, Hercules, CA) and stopped using 1 N sulfuric acid ...
-
bioRxiv - Cell Biology 2022Quote: ... The reaction mixture (total volume 22 μl) contained 11 μl of 2× ddPCR Super Mix for Probes (BioRad, 1863024), 1.1 μl of 4 primers mixture 18 μM each ...
-
Impact of DNA sequences in the DNA duplex opening by the Rad4/XPC nucleotide excision repair complexbioRxiv - Biochemistry 2020Quote: ... The gels were quantitated by autoradiography using Typhoon FLA 9000 imaging scanner (GE) and Image Lab software (Version 5.2.1 build 11, 2014; Bio-Rad). The apparent dissociation constants (Kd,app ...
-
bioRxiv - Microbiology 2019Quote: ... The sample was then loaded onto 11 cm pH 3-10 immobilized pH gradient (IPG) strips (Bio-Rad 1632014) and rehydrated overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunohistochemistry was performed using rat anti-BrdU (MCA2060 GA, Bio-Rad), rabbit anti-Sp7/Osx (sc-22536-r ...
-
bioRxiv - Bioengineering 2020Quote: ... A FITC-conjugated rat anti-mouse CD204 monoclonal antibody (Bio-Rad) was prepared 1:200 in DMEM or CDMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μl primary rat anti-tubulin antibody (Bio-Rad AbD Serotec) at a 1:50 dilution in PBS/1%BSA was added and the slide incubated in a dark wet chamber at room temperature for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CldU primary antibody (rat anti-BrdU, Biorad OBT0030S; Lot# 0109) or IdU primary antibody (mouse anti-BrdU ...
-
bioRxiv - Microbiology 2020Quote: ... The following antibodies were used: mouse anti-rat CD43 antibody (BioRad), rabbit polyclonal Surfactant C (Proteintech) ...
-
bioRxiv - Physiology 2023Quote: ... and rat anti-mouse cd68 (5 µg/mL, MCA1957, Bio-Rad) diluted in PTxwH buffer for 4 days ...
-
bioRxiv - Immunology 2023Quote: ... The expression of immune system markers were mostly studied with inmunohistochemistry using the following antibodies: mouse anti rat CD68 (dilution 1:300 BIORAD, ref. MCA 341R) for monocytes/macrophages ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with beta-mercaptoethanol and denaturated at 95 °C for 5 min before loading on a 12 % PAA precast gel (#4561044, Bio-Rad). The gel was run at 70 V for 15 min and then 100 V for 1 h ...
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Tissue lysates for Western blot were prepared as previously described [11] and sample protein content was determined by Bradford assay (BioRad). Lysates were loaded in 10% polyacrylamide gels and transferred to Immobilon membranes (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... An 11 kPa polyacrylamide (PA) solution (715 µL 50 mM HEPES pH 7.4, 150 µL 2% bis-acrylamide (Bio-Rad), 125 µL 40% acrylamide ...
-
bioRxiv - Molecular Biology 2019Quote: ... Measurement of serum cytokines was performed using multiplex ELISA (human 27-plex #m500kcaf0y, Bio-Rad).
-
bioRxiv - Immunology 2020Quote: Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... Master mixes containing primer pairs against FIBCD1 or B2M (Beta-2-microglobulin, housekeeping gene) were prepared with iTaq Universal SYBR Green Supermix (Bio-Rad #1725122). The mastermixes were dispensed into each well containing cDNA and incubated on ice for 15 minutes to allow the cDNA to dissolve ...
-
bioRxiv - Physiology 2023Quote: ... 0.03% bromophenol blue) containing 9% beta-mercaptoethanol and separated by Mini-Protean TGX gel 4 - 15% (BioRad, stain-free gels #4568084, 4561035) and blotted onto Amersham Hybond-P PVDF membrane ...
-
bioRxiv - Immunology 2021Quote: ... slides were incubated in PBS with rat anti-CD8 (Bio-Rad, YTC182.20) plus either rabbit polyclonal anti-SARS-CoV-2 Spike/RBD (Sino ...
-
bioRxiv - Pathology 2022Quote: ... and rat monoclonal anti-F4/80 antibody (Bio-Rad Laboratories, Inc., MCA497GA). Vectastain ABC kit (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Tub1 (rat monoclonal anti-tubulin alpha, (Bio-Rad Cat# MCA77G, RRID:AB_325003)) (1:10000 dilution each in PBS-T) ...
-
bioRxiv - Neuroscience 2021Quote: ... the rat anti-mouse anti-IFN-γ antibody (Bio-Rad, Oxford, UK) and tyrphostin A47 (a tyrosine protein kinase [TPK] specific blocker ...
-
bioRxiv - Neuroscience 2022Quote: ... Used nest building material was removed from the cages and replaced by 11 g compressed extra-thick blot filter paper (Bio-rad). Every 24h for 5 days ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 µL of each diluted RT and NRT-PCR sample was added to a 22 µL reaction mixture containing 11 µL of QX200TM ddPCR TM Evagreen Supermix (Bio-Rad) and 1.1 µL of each 2 µM ddPCR primers (Table S3) ...
-
bioRxiv - Cell Biology 2022Quote: ... The OD595 for each strain was recorded at the beginning and end of an 11-h incubation period at 30°C using an iMark Microplate Absorbance Reader (Bio-Rad). A detailed outline of the SGA procedure is included in Table S4.
-
bioRxiv - Evolutionary Biology 2023Quote: The ddPCR reactions with a total volume of 22 μl were prepared as follows: 11 μl of 2x ddPCR Supermix for Probes (Bio-Rad), 900 nM of each primer (Sigma-Aldrich ...