Labshake search
Citations for Bio-Rad :
301 - 350 of 6064 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Gels were stained using Coomassie Brilliant Blue R-250 (Bio-Rad) to verify even loading of lanes ...
-
bioRxiv - Physiology 2024Quote: ... or a Coomassie Brilliant Blue R-250 staining (Bio-Rad, #1610400) was used as loading control ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ten-fold diluted cDNA samples (2 μl) were added to a mixture (10 μl total volume) containing iQ™ SYBR® Green Supermix (5 μl; Bio-Rad) and the primers of interest at a final concentration of 10 μM ...
-
bioRxiv - Physiology 2022Quote: ... Primers flanking the target site were used to amplify the target region of the gene in a 10 µL polymerase chain reaction (PCR) containing: 5 µL 2 × SuperMix (Bio-Rad, Hercules, CA), 1 µL genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg in vitro transcripts were transfected into 5,000,000 cells resuspended in 400 µL cytomix containing 2 mM ATP and 5 mM glutathione using a Gene Pulser Electroporator (Bio-Rad, Munich, Germany). Cells were immediately transferred into 12 mL fresh medium and seeded in 96-well plates at density of 20,000 cells/well for replication assays and 12 mL/10cm dish for virus production.
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-5 µg of the non-denatured protein samples were diluted 1:1 with the native sample buffer (BIO-RAD #161-0738) and loaded into the polymerized gel ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Beads were incubated 5 min at 95 °C in this solution and 20 µL of supernatant was analyzed on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins were detected with an infrared imager (Odyssey ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2 M 2-Mercaptoethanol (Bio-Rad), and boiled for 3 min ...
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... 4 μl of the eluate was analyzed by 4-20% SDS PAGE (Biorad) and silver staining ...
-
bioRxiv - Plant Biology 2024Quote: ... 4× Laemmli buffer and 4-20% SDS-PAGE gels were purchased from BioRad.
-
bioRxiv - Genetics 2020Quote: ... and ligated to MseI and EcoRI adaptors (Supplementary Table 4) at 37° C for 2 h in a T100™ Thermal cycler (Bio-Rad Laboratories, Hercules, CA). Success of the digestion/ligation reaction was confirmed on 1.5% of agarose gel electrophoresis ...
-
bioRxiv - Immunology 2023Quote: Plasma from control and infected mice was used at a 1:2 and 1:4 dilution with the Bio-Plex Pro Mouse Cytokine 23 Plex Immunoassay (Bio-Rad Laboratories, Inc., CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... were resolved on a 4-15% or 10% acrylamide gel and transferred onto a PVDF membrane (Invitrogen iBlot 2 or Bio-Rad Trans-Blot Turbo system). Membranes were blocked with 5% milk (standard protein detection ...
-
bioRxiv - Biochemistry 2020Quote: ... were incubated together at RT for 5 min in the presence and absence of 5 mM 2-OG prior to loading on the analytical ENrich 650 column (BioRad Laboratories, Inc., Hecules, USA). The column was equilibrated with 50 mM Tris/HCl and 150 mM NaCl and supplemented with 5 mM 2-oxoglutarate when the complexes were preincubated in the presence of 5 mM 2-oxoglutarate and the applied proteins isocratic eluted with the respective buffer with a flow rate of 1 ml min-1 ...
-
bioRxiv - Microbiology 2021Quote: ... The gel was stained with Commassie Brilliant Blue R-250 (Biorad, #1610436) and imaged using trans-illumination ...
-
bioRxiv - Microbiology 2020Quote: ... gels were stained with Coomassie Brilliant Blue R-250 Staining Solution (BioRad) and visualized using an ImageQuant LAS 4000.
-
bioRxiv - Cancer Biology 2021Quote: ... Gels were stained with Coomassie Brilliant Blue R-250 Staining Solution (BioRad), and a band corresponding to FLAG-TSC2 was excised and submitted to the Perlmutter Cancer Center Proteomics shared resource at NYU School of Medicine (New York ...
-
bioRxiv - Genetics 2020Quote: ... tris-tricine gels were stained (Coomassie Brilliant Blue R-250, Bio-Rad) for 2 h at room temperature and de-stained (40% methanol ...
-
bioRxiv - Microbiology 2022Quote: ... 0.05% (w/v) Coomassie brilliant blue R-250 (Bio-Rad, Philadelphia, PA), 10% (v/v ...
-
bioRxiv - Microbiology 2022Quote: Crude protein lysates stained with Coomassie Brilliant Blue R-250 (BioRad, USA) were sent for mass spectroscopy at the Warwick Proteomics Research Technology Platform ...
-
bioRxiv - Microbiology 2022Quote: ... The gels were stained using Coomassie Brilliant Blue R-250 (Bio-Rad) and de-stained using a solution of 6% ethanol and 3% glacial acetic acid.
-
bioRxiv - Bioengineering 2023Quote: ... and Coomassie Brilliant Blue R-250 Staining Solution were purchased from BioRad. Destain solution was prepared with 10% acetic acid (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gel was stained with 0.1% Coomassie Brillant Blue R-250 (Bio-Rad), dissolved in 40% methanol and 10% acetic acid ...
-
bioRxiv - Microbiology 2024Quote: ... Gels were stained by Coomassie Brilliant Blue R-250 (Bio-Rad, USA). Protein concentration was estimated by Bradford method and using bovine serum albumin as standard [62].
-
bioRxiv - Bioengineering 2024Quote: ... and interleukin 4 (IL-4)) cytokines run on a Bio-Plex 200 reader (BioRad). Data was collected from only two donors for RANTES ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4-12% acrylamide gels (BioRad) were loaded with protein samples ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the gel was stained with Coomassie Brilliant Blue R-250 (Bio-Rad) for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Gel was de-stained with Coomassie blue R-250 destaining solution (Bio-Rad) for 2 hours with 3 times buffer changes ...
-
bioRxiv - Immunology 2023Quote: ... Transmembrane was performed using a Trans-Blot○R Turbo Transfer System (Bio-rad). The membranes were blocked for 1hr at room temperature with 5% non-fat milk (Research Products International ...
-
bioRxiv - Pathology 2023Quote: ... Gels were then stained with Coomassie Brilliant Blue R-25 solution from BioRad for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... Coomassie Brilliant Blue R-250 (1610400, Bio-Rad Laboratories Inc., Hercules, CA, USA), 50% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...