Labshake search
Citations for Bio-Rad :
301 - 350 of 616 citations for Glucosamine N acetyl 6 Sulfatase GNS Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Molecular Biology 2020Quote: The DNA was denatured using 0.5 M NaOH and 1.5 M NaCl and equal amounts were loaded onto a Hybond N + nitrocellulose membrane (GE Biosciences) using the Bio-Dot apparatus (Bio-Rad). Membranes were washed once with denaturing buffer and wash buffer (3× SSC) ...
-
bioRxiv - Developmental Biology 2022Quote: ... GEM-RT was performed in a C1000 Touch Thermal cycler with 96-Deep Well Reaction Module (Bio-Rad; P/N 1851197): 53°C for 45 min ...
-
bioRxiv - Bioengineering 2019Quote: Proliferation of MSCs was evaluated by determining the total cell count per well (n=3 wells/treatment/time-point) using a TC20 Automated Cell Counter (Bio-Rad).
-
bioRxiv - Cancer Biology 2022Quote: ... The reaction was stopped using glacial acetic acid and the N-glycans desalted sequentially using strong cation exchange (AG 50W X8, Bio-Rad), C18 and porous graphitised carbon (PGC ...
-
bioRxiv - Microbiology 2020Quote: ... The protein concentration of the supernatant was determined by Bradford measurement according to the manufacturer’s instructions (Bio-Rad, cat n° 5000006).
-
bioRxiv - Genomics 2021Quote: ... RNAs were then transferred to a nitrocellulose membrane (GE Amersham HybondTM-N+) using a wet transfer system (Trans-Blot cell, Bio-Rad) at 100 V for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resolved genomic DNA was then transferred to the positively charged nylon membranes (Hybond-N+, Amersham Pharmacia Biotech) using a model 785 vacuum blotter system (Bio-Rad). The Bar amplified fragment (Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were eluted from the gel by freezing the gel pieces at −20°C for 30 min in Freeze ‘N Squeeze DNA gel extraction spin columns (Bio-Rad) and recovering the solution by immediate centrifugation of the columns at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... DNA/protein complexes were transferred to a Hybond-N+ positively charged nylon membrane (Amersham Pharmacia Biotech) using an electroblot transfer system (Bio-Rad) and cross-linked with short-wave UV light in a GS gene linker UV chamber (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... with 10 μg of plasmid DNA expressing LpAsp-GFP or LpCht-GFP as well as pTrex-n-eGFP using a Gene Pulser X cell electroporator (Bio-Rad) and cuvette (2 mm gap) ...
-
bioRxiv - Microbiology 2023Quote: ... 12 % SDS-PA gels were fixed with fixation solution (40 % ethanol, 10 % acetic acid) o/n and stained in Flamingo fluorescent protein dye (Bio-Rad) for up to 6 h and imaged with the ChemiDoc (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and A6p (Table S1) were run on agarose gels and purified using Freeze ‘N Squeeze DNA gel extraction spin columns (Bio-Rad). For manual sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The purified RNA was separate on a 1.2% agarose-formaldehyde denaturing gel and was then transferred to a nylon membrane (Hybond-N+, Cytvia) in 10X SSC buffer using a model 785 vacuum blotter (Bio-Rad). RNA was cross-linked to the membrane using an ultraviolet (UV ...
-
bioRxiv - Microbiology 2023Quote: ... targeting SARS-CoV-2 gRNA and N protein sgRNA were used for the quantification by RT-qPCR using iTaq Universal SYBER Green Supermix (Bio-Rad) and normalised to β-actin using 2-ΔΔCT.
-
bioRxiv - Genomics 2024Quote: ... Samples were then run on a 2% agarose gel with 1x SYBR Safe for 2 hours at 120 V before gel extraction with a Freeze ‘N Squeeze column (Bio-Rad). After extraction ...
-
bioRxiv - Microbiology 2024Quote: Total RNA was loaded onto 8 to 12% PAGE–7 M urea gels and transferred to Hybond-N+ (GE) membranes using a Trans-Blot Turbo Transfer system (Bio-Rad) in 1X TBE ...
-
bioRxiv - Biochemistry 2023Quote: ... to saturate the N-terminal metal binding site,10 prior to buffer exchange using a centrifugal buffere exchange device (Bio-Spin, Bio-Rad) into 200 mM ammonium acetate supplemented with 2 x CMC of C10E5 ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antibodies used for SBA: Alexa 488 labeled mouse anti-human CD9 antibody (MCA469A488, Biorad), PE-labeled mouse anti human CD63 antibody (12-0639-42 ...
-
bioRxiv - Cell Biology 2022Quote: ... along with Rhodamine-conjugated ɑ-GAPDH human Fab fragment (1:1000, Bio-Rad, 12004168). The blots were imaged on the ChemiDoc MP system and quantified using Image Lab software (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Bio-Plex Pro Human Inflammation Panel 1 IL-28A / IFN-λ2 (Bio-rad, 171BL022M), Bio-Plex Pro Human Inflammation Panel 1 ...
-
bioRxiv - Immunology 2023Quote: ... and chemokines dosage by Luminex using the 48-Plex pan-human cytokine kit (BioRad) according to the manufacturer procedure ...
-
bioRxiv - Cell Biology 2022Quote: ... A FAM-labeled probe was used to target human STMN2 gene (dHsaCNS772300147, Bio-Rad) and a Hex-labeled probe was used to target mouse ApoB (dMmuCNS407594696 ...
-
bioRxiv - Cancer Biology 2023Quote: ... media (for mouse or human tissue respectively) and 50 μL Alamar Blue (BioRad, BUF012B), with a corresponding media only control well ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti Human Protein Gene Product 9.5 (PGP9.5) (1:500, MCA4750GA mouse monoclonal, Biorad) for 36 h at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... (ii) genes in RNA virus infection panel of pre-designed human PrimePCR by BioRad; (iii ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 1ng/ml recombinant human fibroblast growth factor (FGF) basic (BioRad, Veenendaal, The Netherlands) and 0.1mM L-ascorbic acid (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... for detecting mLIF or Bio-Plex Pro Human Cytokine LIF Set (Bio-Rad, 171B6011M) for detecting hLIF ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were assessed using 6% polyacrylamide gel (made with 29:1 Acrylamide/Bis Solution, Bio-Rad) electrophoresis ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was quenched with 2µl of 10mM EDTA and desalted with Microbio-spin 6 column (BioRad) to remove unincorporated nucleotides ...
-
bioRxiv - Biochemistry 2020Quote: ... The thiol-reduced protein was exchanged into anaerobic 0.5x TNG buffer using Microbiospin 6 columns (Bio-Rad). The protein concentration was determined by the Bradford assay (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer (25 mM HEPES (pH 7.4) ...
-
bioRxiv - Microbiology 2020Quote: ... separated on 6% acrylamide 8M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Plant Biology 2019Quote: ... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein lysates (50µg) were loaded on a 6% SDS-PAGE gel and transferred to nitrocellulose membrane (BioRad) using a wet electroblotting system (BioRad) ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed with TBST (6 × 5 min) and developed using Clarity Western ECL Substrate (Bio-Rad, California, US). Images were captured with ChemiDoc XRS+ system (Bio-Rad ...