Labshake search
Citations for Bio-Rad :
301 - 350 of 6342 citations for 6 hydroxy 4 6 dihydrofuro 3 2 c pyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... Bio-Beads SM-2 (Bio-Rad) were added to the mixture ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were prepared at 25 µg protein/well with 2X laemmli loading buffer and 2-mercaptoethanol and run on pre-cast 4-15% gels (Biorad). Proteins were wet transferred onto PVDF membranes ...
-
bioRxiv - Cell Biology 2021Quote: ... The input (15 µg) and eluted proteins (∼2% of IPT) were fractionated in 4−15 % SDS-PAGE gels (Bio-rad) and analyzed by immunoblotting ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... Samples were run on a precasted gradient gel (4 – 15% Criterion TGX, 12+2 wells, 45 μl, BioRad, CA, USA) for 45 min at 60 mA ...
-
bioRxiv - Biochemistry 2019Quote: ... 10% of 2 mM EGTA eluates were concentrated and separated on 4%– 20% gradient SDS-polyacrylamide Tris-glycine gels (Biorad). Total protein content was visualized by silver staining ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... The protein extract was solubilized in 2-D lysis buffer (30 mM Tris-HCl pH 8.8, containing 7 M urea, 2 M thiourea and 4% CHAPS. Protein concentration was measured using Bio-Rad protein assay method ...
-
bioRxiv - Microbiology 2023Quote: ... 10 min), centrifuged (1,000 x g, 2 min) and loaded on 10% or 4–20% SDS-PAGE gel (Bio-Rad). Following electrophoresis (60 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sodium-dodecyl-sulfate polyacrylamide gel electrophoresis and transfers of proteins to .45uM nitrocellulose membranes were performed using the Protean 2 or 3 systems (Bio-Rad) and protocols provided by the manufacturer ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°C in a Mini Trans-Blot Cell (Bio-Rad). Membranes were blocked in 3% non-fat dry milk in TBS-T buffer for 30 min at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... and cooled to 4°C using a thermal cycler (Biorad). Next ...
-
bioRxiv - Developmental Biology 2022Quote: ... hold at 4°C in a C1000 Thermal Cycler (Biorad). We then performed RT-qPCR for gene expression quantification of the following genes ...
-
bioRxiv - Neuroscience 2024Quote: ... held at 4 °C (C1000 Touch Thermal Cycler; Bio-Rad). Preamplified cDNA was immediately diluted 1:5 with 20 uL DNA Suspension Buffer and stored at –20 °C until use.
-
bioRxiv - Microbiology 2023Quote: ... and held at 4 °C in a thermocycler (Bio-Rad). The newly synthesized 20 µL cDNA reactions were diluted 1:5 with 80 µL sterile ...
-
bioRxiv - Microbiology 2019Quote: T1L virions (2×1012 particles/ml) were incubated for 5 min at 55°C in a S1000 thermal cycler (Bio-Rad). The total volume of the reaction was 30 μl in virus storage buffer (10 mM Tris ...
-
ATM-mediated DNA damage response in macrophages primes phagocytosis and immune checkpoint regulationbioRxiv - Immunology 2020Quote: ... The RNA sample was denatured by incubating it at 70°C for 2 min in S1000TM or C1000TM Thermal Cycler PCR machine (Bio-Rad). The denatured RNA was quickly transferred on ice ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Reaction mixtures were incubated for 2 hours at 25 °C and quenched by adding 10 μL 4x Laemmli Sample buffer (Bio-Rad). Samples were boiled at 95 °C for 5 min and each 8 μL were loaded onto 12% SDS-PAGE gels ...
-
bioRxiv - Neuroscience 2019Quote: ... 30 μg of each protein sample was denatured and reduced by boiling at 95°C for 5 min in 10% (v/v) 2-mercaptoethanol-containing Laemmli sample buffer (Bio-Rad). Samples were resolved by SDS-PAGE with a precast Tris-glycine gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was incubated at 37°C for 30 minutes then left to cool for 10 minutes before adding 6 μL of 0.2% 2-mercaptoethanol in SDS-page loading dye.38 Samples were then heated to 94°C for 2 minutes and added to the wells of a pre-cast 12% polyacrylamide gel (Bio-Rad). The gel was run for 45 minutes at 120 V in running buffer (25 mM Tris ...
-
bioRxiv - Physiology 2022Quote: ... followed by a final melting curve analysis from 70°C to 95°C with 0.2°C increment for each step using the CFX96 Real-Time PCR System and the Precision Melt Analysis software (Bio-Rad). For HMA analysis ...
-
bioRxiv - Biochemistry 2023Quote: ... in a 100 μL reaction for 2 hours at 37°C and purified using Micro-Bio P-30 spin columns (Bio-Rad). The radiolabeled probe was heated to 90°C for 2 minutes and resuspended in 10 mL of ULTRAhyb Oligo hybridization buffer (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... This mixture was then incubated at 4°C for 2 h with gentle agitation before reconstitution was initiated by removing detergent by incubating with Bio-beads (Bio-Rad) at 4°C overnight with constant rotation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mL of stacking gel solution (enough for one 1.5 mm Bio-Rad mini gel cast) was prepared by mixing together ...
-
bioRxiv - Microbiology 2020Quote: ... concentration of total aerobic GNB and of MDR-GNB were determined by plating serial dilutions (pure, 10−2, 10−4) of initial faeces or EA sample onto Drigalski agar (Bio-Rad) with or without 1mg/L cefotaxime ...
-
bioRxiv - Biophysics 2020Quote: ... Inputs (2 μl) and elutions (10 μl) samples were analyzed by 4-15% SDS-PAGE (MINI-PROTEAN TGX stain-free, Bio-Rad) and staining with Quick Coomassie (Generon ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second serum panel (n=29 ...