Labshake search
Citations for Bio-Rad :
3251 - 3300 of 10000+ citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The transcribed product was then electroporated into Vero E6 cells using a Gene Pulser Xcell (Bio-Rad Laboratories, Hercules, CA) and incubated at 37°C for 4 days ...
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed once with PBS and then crosslinked on ice using 0.8 J/cm2 of 254 nm UV light in a GS Gene Linker (Bio-Rad). Cells were then lysed on the tissue culture plate by adding 1 ml of RAP lysis buffer (10 mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2020Quote: ... Animals were electroporated at 300 V for 10 ms (unless otherwise specified) by square-wave single pulse using a Bio-Rad Gene Pulser (BioRad). Immediately after the electroporation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Qauntification and data analysis of the respective genes were assessed using the CFX manager of real-time PCR (Bio-Rad). The Ct values were calculated for each gene and were compared with the reference gene beta-actin ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5×106 Jurkat T cells were electroporated with 2 μg minigene constructs using 220 V and 1,000 mA (Gene pulser X,Bio-Rad). After 24 h incubation ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... We ran samples in duplicate for each gene on the same 384-well plate using a CFX384 Touch Real-time PCR detection system (BioRad). We validated all primers for this study by running a 10-fold serial dilution to determine amplification efficiencies (average ...
-
bioRxiv - Biochemistry 2021Quote: ... and electroporated (2500 V, 200 Ω, 25 μF, exponential decay, time constant ~ 4 ms) using Gene Pulser Xcell (Bio-Rad). 1 mL warm BHI medium was added and the cells were incubated at 30 °C for 6 h under shaking at 200 rpm and plated on BHI agar plates with 10 μg/mL erythromycin ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... with the main exception that the standard square curve electroporation (two pulses at 30V for 3 ms with an interval of 100 ms) was performed once or four times with an interval of 3s Gene Pulser Xcell (Biorad). Zygotes were cultured to two-cell embryos and transferred into pseudopregnant females ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transient gene expression in onion epidermal cells was performed using a Biolistic PDS-1000/He Particle Delivery System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The primers were designed to selectively amplify the target pathogen genes (Table S15) and qRT-PCR was performed using Sso Advanced Universal SYBR Green Supermix (BioRad) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... To this end, BHK-21 cells were electroporated (1500V, 25μFd, no shunt resistance) using a Gene pulser apparatus (Bio-Rad) with viral RNA produced by in vitro transcription (RiboMax P1300 ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was measured using 100 ng of cDNA and 0.5 µM of gene specific primer (see Table S3) and 1x SYBR (Bio-Rad) in a qPCR QuantStudio 7 Pro (ThermoFischer Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... and psbC genes was performed on a Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Oslo, Norway) using the iProof High-Fidelity PCR Kit (Bio-Rad Laboratories ...
-
bioRxiv - Plant Biology 2022Quote: ... The cDNA of the three genes were amplified by PCR using iProof HF Master Mix (Bio-Rad, Hercules, CA, USA) and cloned into the pJET1.2 vector (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... were chosen as the most stable reference genes based on the results from the CFX Maestro Software 1.1 (Bio-Rad). RNA was extracted using RNeasy Kit (Qiagen ...
-
bioRxiv - Physiology 2024Quote: ... Gene expression was analyzed by quantitative real-time PCR (qRT-PCR) using the SsoAdvanced Universal SYBR Green Supermix (BIO-RAD). Expression of the genes of interest was detected with the following primers (5’-3’) ...
-
bioRxiv - Immunology 2024Quote: ... mixed with 25 μl 1.5 mM CaCl2 and 42 μl ddH2O using 2 mm gap cuvettes with 3.5 msec/500 volt in BIORAD Gene Pulser Xcell Electroporation System (BioRad, USA). Transfected cells were immediately transferred into 5 mL prewarmed medium in 25 cm2 flasks and left to recover overnight at 26 °C ...
-
bioRxiv - Genetics 2024Quote: Relative quantification of gene expression was analysed by RT-qPCR using CFX96 Touch Real-Time PCR Detection System (Bio-Rad). For the amplification of gene fragments with a length of 150 to 250 bp ...
-
bioRxiv - Genetics 2023Quote: The expression levels of non-ribosomal peptide synthetase genes were assessed using a real-time amplifier CFX96 (Bio-Rad, USA) and a commercial “PCR-mix SYBR Green I kit” (Syntol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... amoebiformis CCMP2058 cells were transformed with 10 μg of the plasmid using a Gene Pulser Xcell electroporation system (Bio-Rad), as described previously (Fukuda et al ...
-
bioRxiv - Plant Biology 2023Quote: ... Linearized plasmid was mixed with 250 μL of cells at 15°C in a 0.4 cm gap electroporation cuvette and transformed immediately by electroporation using a Gene Pulser II (Bio-Rad) set to 800V and 25 μF ...
-
bioRxiv - Immunology 2022Quote: ... and electroporated at 1500 V with an average time constant of ∼4.5 ms using a Gene Pulser Xcell Electroporation System (Bio-Rad), which was repeated for the entire transformation mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... Oocytes were electroporated in OPTI-MEM containing the guide RNA mix utilizing using a BioRad Gene Pulser (BioRad, Feldkirchen, Germany). After recovery and washing ...
-
bioRxiv - Microbiology 2023Quote: ... The qRT-PCR was performed using gene-specific primers with the SYBR Green method using the real-time PCR machine (BioRad). The relative gene expression was analysed by the comparative 2-ΔΔCt method using CFX 96 software (BioRad) ...
-
bioRxiv - Immunology 2023Quote: ... and gene expression was analyzed using the TP SYBR 2x mastermix (TopBio) on a CFX 1000 Touch Real time cycler (BioRad). Expression of a specific gene in each sample was normalized to expression of RpL32 (FBgn0002626).
-
bioRxiv - Cancer Biology 2023Quote: ... Sso Fast EvaGreen Supermix was performed to analyze gene expression on a BioRad CFX96 Real-Time System (BioRad, Hercules, CA). Relative quantification of gene of interest was established using RPL17 as reference and calculated using the comparative Ct method.
-
bioRxiv - Bioengineering 2023Quote: ... was electroporated (pulsed twice using a square wave of 850 volts for 25 milliseconds) into BHK-21 cells using a Gene Pulser Xcell electroporator (BioRad); transfected cells were cultured in a T175 for 48h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µL plasmid was added to 100 µL electrocompetent cells in a chilled Gene Pulser/MicroPulser electroporation cuvette with 0.1 cm gap (Bio-Rad) and incubated on ice for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... and primers (Table S3.) were used to amplify genes of interest (C1000 Thermal Cycler with CFX96 Real-Time System, BioRad). Primers were made with NCBI Primer Blast76 ...
-
bioRxiv - Microbiology 2023Quote: ... the bacteria were resuspended in 100 µL of 300 mM sucrose solution and transferred to a Gene Pulser Cuvette (0.2-cm electrode gap, Bio-Rad), and 100 ng of plasmid DNA (pEB1GM or pEB2GO ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression analysis was done by qPCR using cDNA (300-fold dilution) and SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Primers used for qPCR were designed using Geneious Prime software and purchased from IDT ...
-
bioRxiv - Developmental Biology 2024Quote: ... the absolute number of NEUROG2-mCherry KI gene copies per cell was quantified and normalized to RPP30 (Bio-Rad, 10031243). 20 ng of genomic DNA was used in 20 µl PCR reaction containing 900 nM of the forward and reverse NEUROG2-mCherry KI and RPP30 primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... cuvette gap width 0.4 cm) with 10 µg of in vitro transcribed HCV full-length RNA using the Gene Pulser Xcell system (BioRad). Cells of two electroporations were combined in 20 ml of DMEM complete and seeded into one 15 cm dish ...
-
bioRxiv - Cell Biology 2024Quote: ... and approximately 1 μg of plasmid DNA was electroporated into the cells by pulsing twice at 1000 V with the Xcell gene pulser (Biorad). The cells were incubated with subsequent addition of healing solution (2 mM CaCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... digital droplet PCR was used to quantify copies of viral gene K1 using the QX200 Droplet Digital PCR System (BioRad). Probe sequence was 5’-/56-FAM/CGG CCC TTG /ZEN/TGT AAA CCT GTC /3IABkFQ/ -3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µl of the ligation product was added to 50 µl of NEB 10-beta competent bacteria and transferred to an ice-cold 0.2 cm Gene Pulser cuvette (Bio-Rad) for electroporation (25 µF ...
-
bioRxiv - Immunology 2024Quote: ... After electroporation at 160V during 10 ms (500µF) with a exponential waveform using the Gene PulserXcell Electroporation systems (Bio-rad), transfected JY cells were seeded in pre-warmed culture medium and used for experiments 24-48h after electroporation ...
-
bioRxiv - Immunology 2024Quote: ... 10 μg capped RNAs were next delivered to cells by electroporation using a Gene Pulser X cell 617BR 11218 (BioRad).
-
bioRxiv - Microbiology 2024Quote: ... The relative expression of each gene was calculated using the ⍰ ⍰CT method with CFX (version 3.1) manager software (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was then used as a template for target gene amplification by qPCR using iTaq Universal SYBR Green Supermix reagent (Biorad) and CFX384 Touch Real-Time PCR system (Biorad) ...
-
bioRxiv - Biophysics 2020Quote: ... Protein concentrations were determined using unlabeled wild-type proteins (β or PCNA) as standards in a Bradford assay (BioRad). Fluorophorophore concentrations were determined from absorbance measurements and molar absorptivities as described previously (9,10).
-
bioRxiv - Cell Biology 2020Quote: ... Identical amounts of proteins (20-40μg) were electrophoresed on 4–15% Mini-PROTEAN TGX precast protein gels (Bio-Rad). For transfer ...
-
bioRxiv - Immunology 2021Quote: ... and protein was quantified from the supernatant of each sample using the DC protein assay (Bio-Rad Laboratories, Inc.). NuPAGETM LDS sample buffer (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μl of lysate was used for protein determination by the DC Protein Assay (Bio-Rad Laboratories, Hercules, CA).
-
bioRxiv - Neuroscience 2021Quote: ... The protein gel was transferred to the PVDF membrane (Immun-Blot PVDF Membranes for Protein Blotting, BioRad, Philadelphia, PA) using a wet transfer system (Wet Tank Transfer Systems ...
-
bioRxiv - Immunology 2021Quote: ... Total protein lysate was analyzed by SDS-PAGE using precast 4-20% Criterion TGX protein gels from Bio-Rad Laboratories (5671093) ...
-
Glyoxal Does Not Preserve Cellular Proteins as Accurately as PFA: A Microscopical Survey of EpitopesbioRxiv - Cell Biology 2019Quote: ... Fifty micrograms of protein from each group was separated on 10% Tris-HCl gel using protein electrophoresis (BioRad, USA). The gels were stained in Coomassie brilliant blue overnight (o/n) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The efficiency of the total protein extraction was evaluated by SDS PAGE followed by stain-free protein imaging (BioRad). For Western blotting ...
-
bioRxiv - Microbiology 2019Quote: Protein samples were resolved on 4-20% Mini-PROTEAN TGX Precast Protein SDS-PAGE gels (BioRad Laboratories; Hercules, CA) and blotted on PVDF membranes using the Trans-Blot Turbo transfer system (BioRad) ...