Labshake search
Citations for Bio-Rad :
3201 - 3250 of 10000+ citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Proteins were separated by electrophoresis using 4-12% Bis-Tris mini protein gels and transferred to PVDF membranes (BioRad). Blots were incubated with primary antibodies at 4°C and then with HRP conjugated secondary antibodies for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 tablet EDTA-free protease inhibitors) and protein content was determined using a Bradford protein assay (Bio-Rad, #5000001). 50-100 µg protein was run on an SDS-PAGE and blotted using a wet-transfer system (Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... Total protein concentration was determined by a detergent compatible DC™ Protein Assay Kit II (Bio-Rad Laboratories, #5000112). For Western blot analysis ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The protein concentration in the thylakoid membrane fraction was determined via Bradford’s method (Protein Assay, Bio-Rad, Hercules, CA) using a bovine serum albumin solution of known concentration as a standard.
-
bioRxiv - Neuroscience 2024Quote: The total amount of protein present in the samples was quantified using the Bio-Rad Protein assay (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Biochemistry 2020Quote: ... Detection antibodies used: anti-human F(ab’)2 IgG-HRP (STAR126P, Bio-Rad), anti-His5-Tag IgG-HRP (MCA5995P ...
-
bioRxiv - Microbiology 2022Quote: ... and Bio-Plex Pro Human Cytokine 27-plex assay (Bio-Rad, California, USA) were used to detect urinary cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... and a goat anti-human IgG conjugated to HRP (Bio-Rad, cat. 204005) was used as secondary antibody ...
-
bioRxiv - Immunology 2021Quote: ... Supernatants were analyzed using a human Th17 cell cytokine panel multiplex (BioRad 171AA001M). For flow cytometry ...
-
bioRxiv - Bioengineering 2020Quote: ... or AlexaFluor647-conjugated mouse-anti-human CD120a (TNFR1) antibodies (clone H398, Bio-Rad). DAPI was used for dead cell exclusion.
-
bioRxiv - Immunology 2023Quote: ... and Bio-Plex Pro Human IgA detection antibody (Bio-Rad, Cat No. 12014669). For both kits ...
-
bioRxiv - Pathology 2023Quote: ... Immunoglobulins were analysed using a bio-plex pro human isotyping assay (Bio-Rad) according to manufacturer instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and Bio-Plex Pro Human Cytokine Screening Panel Standards (BIO-RAD, Hercules, CA). Cytokine and chemokine concentrations refer to 8-point standard curves.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Membranes were washed 5 time for 5 minutes with PBST and incubated with horseradish peroxidase (HRP) conjugated secondary antibodies (Biorad) for 2 hours at room temperature ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Plant Biology 2019Quote: 5 % Mini-PROTEAN TBE precast gels (Bio-Rad) have been pre-electrophoresed in 0.5x TBE buffer for 60 minutes at 70 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... loaded onto a 5% polyacrylamideTBE gel (Bio-Rad) that had been pre-run for 15 minutes in TB Buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% powdered milk (Bio-Rad 170-6404) resuspended in 1x TBST ...
-
bioRxiv - Genomics 2019Quote: ... Blocked membrane in 5% Blotting-Grade Blocker (BioRad) in TBS-T (50 mM Tris pH 7.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µl precision melt supermix (Bio-Rad, Germany) and 1 µl DNA was used for real-time PCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then sonicated and their protein content was quantified using the Bradford protein assay (Bio-Rad, Hercules, CA, USA). For each sample ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentrations of brain lysate and myelin fractions were determined using the DC Protein Assay Kit (Bio-Rad, Munich, Germany) following the manufactureŕs instruction and measured using the EonTM High Performance Microplate Spectrophotometer (BioTek ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 µg of total protein per sample was loaded on NuPage 4-12% Bis-Tris Protein gels (Thermo Fischer Scientific) or 4–15% Mini-PROTEAN TGX StainFree Protein gels (Biorad) and run at 200 V as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Each gel was loaded with a Precision Plus Protein™ Dual Color Standards as a protein marker (Bio-Rad, 1610374). Gel electrophoresis was stopped when the Bromophenol blue dye reached the bottom of the gel ...
-
bioRxiv - Physiology 2020Quote: ... Protein concentration was determined in triplicate with a commercial colorimetric assay (Protein Assay kit-II; Bio-Rad, Gladesville, NSW, Australia), against bovine serum albumin standards (BSA ...