Labshake search
Citations for Bio-Rad :
251 - 300 of 4736 citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Neuroscience 2024Quote: The human cytokine Luminex 8-plex assay (Biorad) was utilised to measure the concentration of IFNγ ...
-
bioRxiv - Neuroscience 2019Quote: ... 5uL of the sample was loaded into 4-6% polyacrylamide gel along with Precision Plus Protein™ Dual Color Standard (#1610374S, Bio-Rad) and was run at 120 V ...
-
bioRxiv - Bioengineering 2020Quote: ... 4-20% Mini-PROTEAN TGX Precast Protein Gels and Precision Plus Protein Dual Color Standards were purchased from Bio-Rad (Hercules, CA). Maleimide PEG Hydroxyl (MW=5,000 g/mol ...
-
bioRxiv - Neuroscience 2020Quote: ... A gel slice corresponding to 100 to 150 kd was isolated (based on size markers in an adjacent lane; Precision Plus Protein™ Dual Color Standards from Bio-Rad). The gel slice was transferred to a D-Tube Dialyzer Midi Tube (EMD-Millipore) ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were then vortexed for 1 min at max speed and loaded into a 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel and run at constant 100 V for 1 h 45 min in running buffer (25 mM Tris, 190 mM Glycine, 3.46 mM SDS) alongside a Precision Plus Protein Dual Color Standard (Bio-Rad, Cat #1610374) in ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Ampholytes (BioLytes pH 3–10, BioRad, Germany) were added to a total volume of 350 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.2% ampholytes pH 3-10 (BioRad) and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad ...
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Immunology 2021Quote: ... the OD values were read at 450/620 nm by an ELISA plate reader (Bio-Rad, Hercules, CA).
-
bioRxiv - Microbiology 2020Quote: ... Levels of the following 27 cytokines were analyzed using a BioPlex Pro™ Human Cytokine 27-plex Assay kit (#M500KCAF0Y, Bio-Rad, Hercules, CA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... The molecular weights of protein bands were estimated using the Precision Plus Protein™ Dual Color Standards (#161-0374; BIO-RAD, Hercules, CA).
-
bioRxiv - Cancer Biology 2024Quote: ... Protein lysates from each cell line were analysed on multiple gels (four per cell line) with Precision Plus Protein Dual Color Standard (1610394, Bio-Rad, Hercules, CA) as ladder and blotted to membranes to separately probe for phosphorylated and total forms of the same proteins ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg RNA was transferred into the cDNA Ecodry Premix Kit prior to the quantitative PCR program being run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, 1725121). Each reaction proceeded at 50 °C for 2 min ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with Protease and Phosphatase Inhibitor and loaded on 4–15% SDS-PAGE gels (Bio-Rad Laboratories, Inc.). Proteins were transferred on a nitrocellulose membrane (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... and goat α-mouse or α-rabbit IgG alkaline phosphatase (AP)-conjugate antibodies (Bio-Rad Laboratories, #1706520, #1706518).
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... followed by measuring the absorbance of individual wells at 450 nm using an ELISA reader (Bio-rad mod.550). Serum samples from unmanipualted mice were used for negative controls.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Immunology 2022Quote: ... Generated cDNA was used for real-time qPCR using respective gene targeted intron-spanning gene-specific unlabeled primers and dual-labeled fluorescent FAM probes with a proprietary quencher molecule (PrimePCR™, Bio-Rad, Hercules, CA). Thresholds were set objectively to determine cycle thresholds (CT) ...
-
bioRxiv - Immunology 2023Quote: ... separated by electrophoresis and transferred to nitrocellulose membrane accordingly.1 The molecular mass of protein was determined by comparison with the migration pattern of Precision Plus Protein™ Prestained Standards Dual Color (Biorad Laboratories, CA, USA). The primary antibodies used were anti-pAKT (S473) ...
-
bioRxiv - Plant Biology 2023Quote: ... Seed storage proteins were visualized from 100 µg of seed material on a 12% SDS-PAGE compared to a Precision Plus Dual Color Protein Standard (Bio-Rad, Hercules, CA, USA). Gels were stained for 1 hr using a 0.1% Coomassie Brilliant Blue ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Genomics 2019Quote: ... All blots were visualized using a goat anti-rabbit IgG:alkaline phosphatase fusion protein at 1:3,000 dilution in conjunction with BCIP/NBT color development (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... Plates were washed as previously and to each well 50 µL/well of colorimetric alkaline phosphatase (AP) substrate (BioRad) was added followed by incubation at RT for approximately 15 min or until spots first develop ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg of lysate was heat denatured for 3 minutes at 95°C for 3 minutes and resolved on a pre-cast 4-15 % SDS-PAGE gels (Bio-Rad) at 200V for 45 minutes in 1X running buffer (25mM Tris pH 8.3 ...