Labshake search
Citations for Bio-Rad :
251 - 300 of 7733 citations for Ethyl 2 pyrrolidin 2 yl 2 3 dihydro 1 3 thiazole 4 carboxylate hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... 800 mg Bio- Beads (SM-2 resin, Bio-Rad) were added in 4 portions to the solution ...
-
bioRxiv - Biophysics 2024Quote: ... 2 x Econo-Pac 10DG desalting columns (Bio-Rad) were equilibrated using 20 mL desalting buffer (200 mM KCl ...
-
bioRxiv - Biochemistry 2024Quote: ... then 30 µl of 2× Laemmli sample buffer (BioRad) and 1 µl of proteinase K (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... or anti-rat Ly-6B.2 alloantigen (1:100, MCA771GA, Bio-Rad Laboratories, Hercules, CA) for neutrophils ...
-
bioRxiv - Neuroscience 2020Quote: ... TBS-T) before incubation with HRP-conjugated secondary antibody for 2 hours (Biorad, 1:1000). After 3 times washes with 5 min intervals with TBS-T ...
-
Bacterial Polyphosphates Induce CXCL4 and Synergize with Complement Anaphylatoxin C5a in Lung InjurybioRxiv - Immunology 2022Quote: ... using 1-2 ng cDNA per sample complemented with iQ SYBR®Green Mastermix (BioRad) and specific forward and reverse primers at a concentration of 0.5 µM each ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-5 µg of target protein was resuspended in 2× Laemmli Sample Buffer (Bio-Rad) with adding 1:20 Beta-mercaptoethanol and 15 µL of the mixture was added onto Any kD™ Criterion™ TGX Stain-Free™ Protein gel (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Neuroscience 2020Quote: ... Samples were prepared at 25 µg protein/well with 2X laemmli loading buffer and 2-mercaptoethanol and run on pre-cast 4-15% gels (Biorad). Proteins were wet transferred onto PVDF membranes ...
-
bioRxiv - Cell Biology 2021Quote: ... The input (15 µg) and eluted proteins (∼2% of IPT) were fractionated in 4−15 % SDS-PAGE gels (Bio-rad) and analyzed by immunoblotting ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were centrifuged for 15 min at 10,000 x g at 4 °C and supernatants were collected for protein quantification using the Quick start Bradford protein assay kit 2 (Biorad). Samples were mixed with Laemmli buffer (Biorad ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... Samples were run on a precasted gradient gel (4 – 15% Criterion TGX, 12+2 wells, 45 μl, BioRad, CA, USA) for 45 min at 60 mA ...
-
bioRxiv - Microbiology 2023Quote: ... 10 min), centrifuged (1,000 x g, 2 min) and loaded on 10% or 4–20% SDS-PAGE gel (Bio-Rad). Following electrophoresis (60 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein lysates in Laemmli buffer were separated by electrophoresis on 12% SDS-PAGE gels and transferred for 2 hours at 4°C on to a PVDF membrane (BioRad). After blocking for an hour in 5% dry milk ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... The protein extract was solubilized in 2-D lysis buffer (30 mM Tris-HCl pH 8.8, containing 7 M urea, 2 M thiourea and 4% CHAPS. Protein concentration was measured using Bio-Rad protein assay method ...
-
bioRxiv - Cell Biology 2024Quote: ... IP samples or cell pellets resuspended in SDS sample buffer containing 2-mercaptoethanol were subjected to SDS-PAGE using a 4%-15% pre-cast gradient gel (BioRad), and transferred to a nitrocellulose membrane (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were resuspended in agarose insert buffer and mixed 1:1 with 2% low-melting agarose (Bio-Rad). Gel inserts were solidified at 4°C for overnight and were stored in agarose insert buffer until analysis ...
-
bioRxiv - Physiology 2024Quote: Native-PAGE gels (3% acrylamide:bis-solution 19:1 (BioRad, 1610144)/0.08% ammonium persulfate/0.006% tetramethylethylenediamine (TEMED)/1X TBE ...
-
bioRxiv - Cancer Biology 2021Quote: ... 8% of 2% w/v bis-acrylamide (Bio-Rad, #1610142), 0.5% of 10% ammonium persulfate (APS ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were boiled with 2× Laemmli sample buffer (Bio-Rad) containing 2.5% β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... for 2 min and detected by ChemiDoc imaging system (Biorad). For equal loading analysis ...
-
bioRxiv - Biophysics 2020Quote: ... and 2% bis-acrylamide (#161-0142, Bio-Rad, Munich, Germany) in PBS that are stored at 4°C for a maximum time of 2 months ...
-
bioRxiv - Cancer Biology 2021Quote: ... using 2× iQ Custom Sybr Green Supermix (Bio-Rad Laboratories). Values were normalized on mRNA expression of human β-actin and HPRT (reference genes) ...
-
bioRxiv - Biochemistry 2021Quote: ... 200 mg Bio-Beads™ SM-2 Resin (Bio-Rad) was added and incubated at 4°C overnight while shaking at 650 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x iTaq Universal SYBR Green Supermix (Bio-Rad, 1725125) was used for the Reverse Transcription-Polymerase Chain Reaction (RT-PCR ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 μl 2 x EVA-Green master mix (Bio-Rad), 1 μl HindIII-HF (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Microbiology 2023Quote: ... Detergent was removed using adsorbing SM-2 Biobeads (Bio-Rad): the protein-lipid mix was incubated twice with fresh Biobeads at 10:1 (w:w ...
-
bioRxiv - Microbiology 2022Quote: ... Extracts were diluted with 2□×□Laemmli sample buffer (Bio-Rad) and β-mercaptoethanol (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... including 7.5 μl of 2× iQSYBR Green Mix (Bio-Rad) and 100–300 nM forward and reverse primers ...
-
bioRxiv - Neuroscience 2023Quote: ... 60 mg of Bio-Beads SM-2 (#1523920, Bio-Rad) was added ...
-
bioRxiv - Systems Biology 2024Quote: ... buffer + 2% (v/v) Sodium dodecyl sulfate (SDS, Bio-Rad). Proteins were denatured at 95 °C and 600 rpm for 10 min before adding a final concentration of 2% (v/v ...
-
bioRxiv - Genomics 2022Quote: ... The lysate was added to 2 chromatography columns (7321010, BioRad) packed with 25 mL each of chitin resin (S6651S ...
-
bioRxiv - Microbiology 2022Quote: ... Extracts were diluted with 2 × Laemmli sample buffer (Bio-Rad) and β-mercaptoethanol (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... We placed 2 g/L Chelex 100 resin (Bio-Rad) in the dialysis buffer to chelate divalent metal ions ...
-
bioRxiv - Immunology 2024Quote: ... and 2 % bis-acrylamide solutions (594 µL, #1610142, Bio-rad) were formulated in distilled water (2736 µL ...
-
bioRxiv - Biophysics 2024Quote: ... then detergent was removed with BioBeads SM-2 (Bio-Rad) at 80 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... 4X Laemmli Sample Buffer containing 10% 2-Mercaptoethanol (Bio-Rad) was added to each sample to a final concentration of 1X ...
-
bioRxiv - Bioengineering 2024Quote: ... and 30 % v/v bis-acrylamide 2 % (Bio-rad: 1610142) were added to produce the gels and mixed with 2 % v/v fluorescent carboxylated 200 nm beads (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... and 8 % v/v bis-acrylamide 2 % (Bio-rad: 1610142) were added to produce the gels and mixed with 2 % v/v fluorescent carboxylated 200 nm beads (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... We ran the qPCR reactions using 1-2 µl cDNA in SYBR Green Master Mix (Biorad) totaling 20 µl in a Biorad CFX96 machine using 60°C as the annealing temperature ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in monomer solution (1 x PBS, 2 M NaCl, 2.5% acrylamide (Bio-Rad), 0.15% Methylenbisacrylamide (Santa Cruz) ...
-
bioRxiv - Microbiology 2022Quote: ... Commercial antibodies were used for β-tubulin (clone YL1/2, Bio-Rad, Watford, UK; 1:5000), β-actin (Abcam ab8227 ...
-
bioRxiv - Genetics 2022Quote: ... 1-2 μg RNA was used for cDNA synthesis using the iScript Advanced kit (Bio-Rad), following the manual.
-
bioRxiv - Neuroscience 2024Quote: ... containing Factor 1 and Factor 2 at manufacturer- recommender concentrations (Bio-Rad, Hercules, CA; cat #171304011). Lung tissues were similarly homogenized in RIPA buffer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...