Labshake search
Citations for Bio-Rad :
251 - 300 of 8482 citations for 8 BROMO 4 METHYLTHIO 7 PHENYLPYRAZOLO 1 5 A 1 3 5 TRIAZIN 2 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... the membrane was blocked overnight at 4°C using 5% non-fat dry milk (Bio-Rad, catalog 170-6404) in Tris-buffered saline pH 7.3 ...
-
bioRxiv - Neuroscience 2019Quote: ... ~5 μg of protein per lane was separated on 4-15% TGX gels (Bio-Rad Laboratories, Hercules, CA, USA) at 200V for 40 minutes in tris-glycine running buffer (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... Samples (5 μL) were then loaded on precast gradients (4-15%) SDS-polyacrylamide gels in duplicate (Bio-Rad Laboratories) and subjected to electrophoresis at 180 V for 40 minutes using pre-made 1x SDS-PAGE running buffer (Ameresco) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... pH 8.3) running buffer by loading 5 μg sample onto 4-20% Mini-PROTEAN® TGXTM gels (Bio-Rad) with iBrightTM Prestained Protein Ladder (#LC5615 ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein samples were heated at 95°C for 5 minutes and 10µL were loaded on SDS-PAGE gels (4-20%Mini-PROTEAN TGX Stain-Free, BioRad). After electrophoresis ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µL of the supernatant was loaded into a 4−20 % Mini-PROTEAN-TGX gel (BioRad, Hercules, CA, USA), run at 165 V for 50 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg/sample was loaded onto 4-15% gradient polyacrylamide gels (Mini-PROTEAN TGX Gels, Bio-Rad, 4561083), transferred (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: ... Total protein (5∼15 µg) was loaded and separated by 4–20% pre-made SDS-PAGE gels (#4568095, BioRad, Mini-PROTEAN TGX Stain-Free Precast Gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Maltose-1-phosphate was separated from orthophosphate by anion exchange chromatography using Dowex 1 × 8 100-200 mesh (Bio-Rad, 28 x 1.6 cm ...
-
bioRxiv - Immunology 2020Quote: ... mixed with Rotiload (1:4, BIO-RAD, Feldkirchen, Germany) and boiled for 5 min ...
-
bioRxiv - Microbiology 2024Quote: ... diluted 1:4 in Laemmli sample buffer (Bio-Rad) and heated for 10 minutes at 98°C ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1:1000, BioRad). As secondary antibodies Horseradish Peroxidase (HRP ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μl of the cDNA sample were supplemented with 5 μL of SsoADV Universal SYBR Green Supermix (BioRad) mix 2X ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... 0.25 U Taq DNA polymerase and 1 µL of DNA template (5-10 ng/µL) on a T100 TM Thermal Cycler (Bio-Rad). Thermal cycling conditions for bacteria and archaea were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... the membranes were further incubated in secondary antibody solutions (TBST with 5% Non-Fat Dry Skinned Milk and Horseradish Peroxidase conjugated secondary antibodies Goat Anti-Rabbit/Mouse, 1:10000, Bio-Rad) for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were subsequently centrifuged at 1200 rpm for 5 minutes before their pellets being resuspended in 1 ml medium for cell counting using TC10 automated cell counter (BioRad USA) before re-plating ...
-
bioRxiv - Bioengineering 2022Quote: ... All the eluted fractions were tested using a Bradford reagent assay (diluted 1:5 with ddH2O) (190 μL Bradford, 10 μL sample) (Bio-rad). Positive fractions were desalted using 100 kDa amicons (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... 7.5 μl of SsoAdvanced Universal SYBR Green Supermix and 1 μl of the following DNA templates (Prime PCR Assay, Bio-Rad): mt-Co2 (mitochondrial ...
-
bioRxiv - Neuroscience 2021Quote: ... ChAT) for 5 minutes or ECL Standard (β -actin) for 1 minute and then imaged using the ChemiDocMP Imaging System (BioRad). One sample from the Vehicle group was excluded from analysis for the BDNF western blot due to a transfer bubble over the band of interest for that sample ...
-
bioRxiv - Genetics 2022Quote: ... Blots with HRP-linked secondary antibodies were additionally incubated for 1-5 minutes with Clarity or Clarity Max ECL Western Blotting substrates (Bio-Rad). Blots were then imaged on a ChemiDoc MP Imaging System and analyzed with Bio-Rad Image Lab software (v5.2.1).
-
bioRxiv - Cancer Biology 2019Quote: ... cells were incubated for one hour either with a 1:5 dilution of Rat anti Human CD3:Alexa Fluor®647 (0.05 mg/mL) (clone CD3-12; Bio-Rad) or with undiluted CD8 (AM22 ...
-
bioRxiv - Genetics 2020Quote: ... membranes were washed in × 1 Tris-buffered saline-Tween (TSBT) and then blocked for ~10 min in 5% blocking buffer (Bio-Rad) in 1 × TBST ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:5 and then 2μl was added to 5ul SYBR green PCR mixture (BioRad, 1725271, Hercules, CA, USA), 2.4ul water and 1.25 pmol primer mix ...
-
bioRxiv - Biochemistry 2020Quote: ... in TBST/5% wt/vol non-fat milk (1 h, RT), washed (5x, TBST) followed by addition of ECL substrate (Bio-Rad) and imaged (ChemiDoc ...
-
bioRxiv - Physiology 2022Quote: ... diluted 1:2500 in PBS-Tween 5% milk was used to detect primary antibodies bound to the blot by BIO-RAD ChemiDoc imaging system ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were subsequently centrifuged at 1200 rpm for 5 minutes before their pellets being resuspended in 1 ml medium for cell counting using TC10 automated cell counter (BioRad USA) before re-plating ...
-
bioRxiv - Neuroscience 2023Quote: ... First strand cDNA samples were diluted 1:10 and 5 μL was used as template with ddPCR Supermix for Probes (No dUTP) (Bio-Rad) and TaqMan Gene Expression Assays (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... GFP-tagged proteins were detected using anti-GFP (Wako, mFX75, 1:5 000 dilution) antibodies combined with Goat Anti-Mouse IgG (H+L) HRP Conjugate (Bio-Rad). Images were acquired using Amersham Imager 600 (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... 2% formaldehyde gel and separated at 125-150V at 4°C for 1-2 h and then transferred to a Zeta-Probe GT membrane (Bio-Rad) via capillary action overnight (Streit et al. ...
-
bioRxiv - Microbiology 2019Quote: ... using Bio-Plex Amine Coupling Kit (Bio-Rad, Catalog# 171-406001) according to the manufacturer’s suggestions and diluted to a final concentration of 5×106 beads/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-Drosophila AMPK1/2 (BioRad, 1:1000), rabbit anti-diphosphorylated ERK (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... ERK1/2 (1:1000, Bio-Rad Cat# MCA4695T), horseradish peroxidase-conjugated anti-rabbit (1:5000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... bromophenol blue) was applied onto IPG strip (7 cm, pH 3-10, Bio-Rad, 1632000) for 24 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Products were detected by running an 8% acrylamide gel (19:1 acrylamide:bisacrylamide) (Bio-Rad), 1X TBE ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal amounts of protein (5–20 μg) were loaded into each lane and separated on 4–20% polyacrylamide tris glycine SDS gels (BioRad), then transferred to polyvinylideneifluoride membranes (BioRad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were boiled at 95 °C for 5 mins with 6xSDS sample buffer before loading onto 4-20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Biophysics 2021Quote: ... 10 mM borate pH 10 was prepared at 5 μM and loaded onto a 4-20% Mini-Protean TGX pre-cast gel (BioRad). 10 μL of each folding sample was subsequently loaded onto the same gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then washed with IP lysis buffer three time and boiled in 25 ul of 2X SDS-loading buffer for 5 minutes and loaded into 4-15% polyacrylamide gels (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl; BioRad) and transferred onto Immun-Blot PVDF 0.2 µm (BioRad ...
-
bioRxiv - Cell Biology 2019Quote: ... a total of 15 μg siRNA (5 μg from each siRNA) was transferred to a 4-mm cuvette (Bio-Rad) and 5-10×106 DCs were added in 200 μl OptiMEM and incubated for 3 min before being pulsed with an exponential decay pulse at 300 V ...
-
bioRxiv - Cell Biology 2021Quote: Purified substrates and enzymes were centrifuged (16,000 g, 5 min, 4°C) before protein concentration was determined by Bradford assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were denatured by boiling in 1x Laemmli buffer at 95°C for 5 minutes and loaded on a 4–20% gradient gel (BioRad). PVDF membranes were used for proteins wet transfer (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was boiled at 95⁰C for 5 minutes prior to electrophoresis on a 4-20% gradient SDS-PAGE gel (BioRad). Membrane was blocked with 5% skim milk in TBST 1x on rocker for 1 hour ...