Labshake search
Citations for Bio-Rad :
251 - 300 of 840 citations for 6 chloro N 3 methoxypropyl pyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and 3 mg Bromophenol Blue) were separated by SDS-PAGE using 4-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Microbiology 2019Quote: ... The sample was then loaded onto 11 cm pH 3-10 immobilized pH gradient (IPG) strips (Bio-Rad 1632014) and rehydrated overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNAs of each sample were resolved on 10% Criterion TBE-urea polyacrylamide gel (Bio-Rad), and processed with the standard procedure described previously (63) ...
-
bioRxiv - Biochemistry 2022Quote: Proteins for native mass spectrometry were held on ice and buffer exchanged into 75 µl of 50 mM ammonium acetate pH 7.5 by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... followed by 3 min at room temperature using a thermocycler (MJ Mini Personal Thermal Cycler PTC 1148, Bio-Rad) Samples were centrifugated at 100 000 g for 20 min at 4 °C.
-
bioRxiv - Immunology 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... The membrane was again washed 3 times with TBST and then placed in Clarity Max Western ECL (Bio-Rad) substrate for 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... All reactions were performed in 3 technical replicates using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Data was analysed according to the 2-ΔΔCT method52.
-
bioRxiv - Biochemistry 2023Quote: ... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-Rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... All cDNA samples (3 biological replicates) were run in SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad, 1725271) in 3 technical replicates for 40 cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... After 3 washes with TBS-T signal was developed for HRP secondaries with Clarity Western ECL Substrate (Bio-Rad). CIRBP and RPA2 expression were each measured with 3 different antibodies targeting conserved epitopes (Extended Data Figure 7c ...
-
bioRxiv - Biophysics 2023Quote: ... Blotting was done by standard mini-TGX protocol (2.5 A, 25 V, 3 minutes) using a Trans-blot Turbo Transfer System (BioRad). Membranes were incubated with UBQLN2 primary antibodies (1:5000 diluted ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase activity was measured as described in the FAM FLICA caspase 1 and 3 kit (Bio-Rad, Hercules, USA). Lysosomal and mitochondrial content as well as production of ROS were analysed by staining with 50 nM LysoTracker™ Deep Red ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Microbiology 2023Quote: ... qPCR was then performed on a Quantstudio 3 using the indicated targets and with iTaq Universal SYBR Green (BioRad). RQ values were calculated using a standard curve ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–PAI-1 antibody was coupled to carboxylated polystyrene beads (Luminex) using a Bio-Plex amine coupling kit (Bio-Rad). The coupled beads were then incubated with samples and bound PAI-1/tPA complexes detected using biotinylated rabbit anti-tPA antibody (Molecular Innovations ...
-
bioRxiv - Immunology 2022Quote: Luminex beads used for the serological and purified antibody binding assays were prepared by covalent coupling of SARS-CoV-2 proteins with MagPlex beads using the manufacturer’s protocol with a Bio-Plex Amine Coupling Kit (Bio-Rad, France). Each of the SARS-CoV-2 Spike proteins expressed with different mutations were coupled with different colored MagPlex beads so that tests could be performed with a single protein bead per well or in a multiplexed Luminex binding assay ...
-
bioRxiv - Microbiology 2023Quote: ... Distinct MagPlex microsphere sets (Luminex Corp, Austin, TX, USA) were respectively coupled to viral antigens using the amine coupling kit (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2022Quote: ... stock solution of 40% neutral acrylamide and N,N’-methylenebisacrylamide in a 19:1 ratio (Bio-Rad) were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA samples (3 μl) and master mixes (7 μl) were pipetted into a 96-well PCR plate (Bio-Rad #MLL9651) and PCR amplification performed using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Immunology 2020Quote: Densitometric analysis of cleaved caspase 3 immunoblots from three independent experiments were performed using the VersaDoc Imaging System (Bio-Rad) and analyzed with ImageJ 1.52p Fiji package software (https://imagej.net/Fiji) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were separated at 175 V for 3-4 hours at 4°C and then transferred to nitrocellulose membrane (BioRad) by using a Criterion blot cell (BioRad ...
-
bioRxiv - Molecular Biology 2021Quote: ... The protein bound GST beads were washed 3 times in the GST lysis buffer by centrifugation at 1,000 rcf for 3 minutes and resuspended in 4X Laemmli sample buffer (Bio-Rad), heat denatured and centrifuged at 1,000 rcf for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were centrifuged for 5 min at 7,000 g and washed twice with 200 μL of 1x PBS containing 3% BSA and 0.1% (v/v) Tween-20 (BioRad, Germany). Mounting of cells for STED microscopy was performed as described above.
-
bioRxiv - Cancer Biology 2021Quote: ... Scientific until approximately 3 cm of separation was obtained between the 25 and 37 kDa protein standards (Bio-Rad; 1610375). Using electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were in-gel rehydrated for 16 hrs and isoelectrically focused on 7 cm pH 3-10 IPG strips to 10,000 Vh on a Protean® IEF Cell (BioRad). After focusing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 3 technical replicates and were carried out using a CFX384 TouchTM Real-Time PCR Detection System (BioRad Laboratories Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were run in 3-12% Bis-Tris gradient gels and transferred to PVDF membranes in a wet blot system (BioRad). Membranes were dried ...
-
bioRxiv - Microbiology 2020Quote: ... were mixed in a 1000:3 ratio and added to the blots prior to visualization via Chemidoc Touch Imaging system (BioRad). For OmpT visualization ...
-
bioRxiv - Cell Biology 2020Quote: ... were added for 4 h and then samples were centrifuged at 10,000g for 3 minutes and washed three times with RIPA buffer and re-suspended in laemmli buffer (Bio-Rad), boiled for 5 minutes ...
-
bioRxiv - Biophysics 2020Quote: ... before being transferred to Whatman 3 MM paper and dried (50°C, 2 hours) using a gel dryer (Model 583, BioRad) attached to a vacuum pump ...
-
bioRxiv - Microbiology 2022Quote: ... Intact cells were divided into 100-μl aliquots and heated individually at different temperatures for 3 minutes in a PCR machine (Biorad), followed by cooling for 2 minutes at room temperature ...
-
Proteolytic cleavage of the extracellular domain affects signaling of parathyroid hormone receptor 1bioRxiv - Pharmacology and Toxicology 2022Quote: ... Lysates were cleared by centrifugation and run on 10% SDS-polyacrylamide gels in a Mini-PROTEAN 3 cell apparatus (Biorad). Proteins were electroblotted onto Immobilon P membranes (Millipore ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Biophysics 2019Quote: Proteins for native mass spectrometry were buffer exchanged into 50mM ammonium acetate by 3 rounds of gel filtration using BioGel P6 (Biorad) spin columns according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A total of 3 μg of protein was loaded to Mini-PROTEAN TGX Stain-Free Gels (10% gel, BIO-RAD). Proteins were transferred to standard PVDF membranes through an OWL semi-dry transfer apparatus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Bound proteins were washed 3 times in 500 mM KCl and eluted on Bio-spin disposable chromatography columns (Bio-Rad) with flag peptide as described in (88) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Developmental Biology 2020Quote: ... Western blots were performed either with Criterion ™ XT Tris-Acetate Precast Gels 3–8 % (3450130, Bio-Rad, Hercules, CA), XT Tricine running buffer (161–0790 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers (Table 3) were designed using Primer3 Plus (31, 32) to quantify transcripts using Universal SYBR Green Supermix (Bio-Rad) using a Quantstudio 6 Flex (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 μg of total RNA was used in the reverse transcription reaction using the iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR amplification was performed on the Prism 7900 Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... ± phosphatase inhibitor cocktail 3) and incubated for 30 min on ice before addition of MnCl2 and λ-phosphatase (Bio-Rad) to the appropriate samples for 30 min at 30°C ...