Labshake search
Citations for Bio-Rad :
251 - 300 of 3523 citations for 6 BROMO 4' METHYLFLAVONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... Proteins were separated on 4-15% gradient gels (BioRad). For whole extract and the supernatant fraction after immunoprecipitation ...
-
bioRxiv - Bioengineering 2021Quote: ... A 4-20% Mini-PROTEAN Precast Protein Gel (BIORAD) was loaded with samples and run at 120V for 60 minutes with a Mini-PROTEAN Tetra Cell (BIORAD) ...
-
bioRxiv - Bioengineering 2021Quote: ... loaded into a 4–15% polyacrylamide gel (Bio-Rad), and left to run for 1 h at 100V ...
-
bioRxiv - Immunology 2020Quote: ... or on Mini-Protean TGX 4-15% gels (Biorad) and stained with Coomassie Blue ...
-
bioRxiv - Biochemistry 2021Quote: 4-20% Mini-PROTEAN Gels (Bio-Rad, Cat. # 4561096)
-
bioRxiv - Immunology 2020Quote: ... mixed with Rotiload (1:4, BIO-RAD, Feldkirchen, Germany) and boiled for 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... After fixing in 4% paraformaldehyde (Bio-Rad Laboratories, Inc.) for 15 min at room temperature and staining with 10 ng/ml Hoechst 33342 ...
-
bioRxiv - Microbiology 2022Quote: ... 4–20% Mini-PROTEAN TGX Gels (Bio-Rad #4561093) were used for electrophoresis ...
-
bioRxiv - Neuroscience 2023Quote: ... using a 4-20% acrylamide gradient gel (Bio-Rad). Proteins were transferred to an Immobilon polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biochemistry 2023Quote: ... or 4-20% Criterion TGX-stain free gels (BioRad) and using 7.5 % SDS-PAGE using 1x Tris/glycine-SDS buffer (BioRad) ...
-
bioRxiv - Biochemistry 2023Quote: ... resolved on a 4-20% SDS-PAGE gel (BioRad), and visualized using a Li-Cor Odyssey imager.
-
bioRxiv - Synthetic Biology 2023Quote: ... running on 4-20% SDS-PAGE gel (Bio-Rad and Coomassie blue staining (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... loaded into 4 –20% Tris-Glycine gels (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... Precast 4 to 20% gradient polyacrylamide gels (Bio-Rad) were used to separate the protein samples ...
-
bioRxiv - Microbiology 2023Quote: ... Electroporation was performed in 4 mm cuvettes (Bio-Rad), utilizing GenePulser Xcell with PC and CE modules (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... separated on a 4-20% gradient gel (BioRad, 4561093) and transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 4 × Laemmli buffer (Bio-Rad, Feldkirchen, Germany, 1610747). Separated proteins were transferred to Immun-Blot® PVDF Membranes (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% Tris-Glycine (BioRAD precast gradient gels 5671084) were used for protein separation ...
-
bioRxiv - Molecular Biology 2023Quote: ... were separated on 4-12 % polyacrylamide/SDS gels (Biorad) and transferred to Hybond-ECL membranes (GE Healthcare) ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were run on 4-20% gradient gels (BioRad), stained with Coomassie Blue ...
-
bioRxiv - Microbiology 2024Quote: ... diluted 1:4 in Laemmli sample buffer (Bio-Rad) and heated for 10 minutes at 98°C ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were run on 4-20% TGX gels (Biorad) and blotted with the LPS antibody against P ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4-15% (Bio-Rad; catalog no.: 456-1083) gels ...
-
bioRxiv - Molecular Biology 2024Quote: ... run on 4-15% Mini-Protean TGX gels (BioRad) at 100 V for approximately 1.5 hrs and transferred onto nitrocellulose membranes using a Trans-Blot Turbo Transfer System (BioRad) ...
-
bioRxiv - Bioengineering 2024Quote: ... according to 4×Laemmli Sample Buffer (BioRad 161-0747) protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were loaded onto 4-12% gradient gels (Biorad) and resolved for 25 min at 200V ...
-
bioRxiv - Immunology 2020Quote: ... EVs or S-Trim preparations were separated by SDS-PAGE on a 4−15% acrylamide gel (4−15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) and subsequently transferred onto PVDF membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were analyzed by SDS-PAGE (either 4-20% Tris-glycine or 4-12% Bis-tris pre-cast gel, Bio-rad Laboratories, Inc.) and transferred to nitrocellulose membranes (Bio-rad Laboratories ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were separated by SDS-PAGE on a 4-15% acrylamide gel (4–15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) and subsequently immobilized by electro-transfer to PVDF membrane.
-
bioRxiv - Cell Biology 2019Quote: ... Non-denaturated proteins were separated by native-PAGE on a 4-15% acrylamide gel (4–15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) using 25 mM imidazole pH 8.0 as anode buffer and 50 mM Tricine ...
-
bioRxiv - Cell Biology 2023Quote: ... and the lysates were heated for 15 minutes at 50 °C before being loaded onto 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...